S/MARt DB - S/MAR

AC  SM0000236
XX
DT  27.3.2000 18:19:53 (created); ili
DT  27.3.2000 18:19:53 (updated); ili
XX
NA  SV$MAR1
XX
OS  SV40, simian virus 40
OC  viridae; ds-DNA nonenveloped viruses; papovaviridae;
OC  polyomaviruses
XX
SZ  307 bp
XX
SQ  TGGCAAACTTTCCTCAATAACAGAAAATGGATCTCTAGTCAAGGCACTATACATCAAATA
SQ  TTCCTTATTAACCCCTTTACAAATTAAAAAGCTAAAGGTACACAATTTTTGAGCATAGTT
SQ  ATTAATAGCAGACACTCTATGCCTGTGTGGAGTAAGAAAAAACAGTATGTTATGATTATA
SQ  ACTGTTATGCCTACTTATAAAGGTTACAGAATATTTTTCCATAATTTTCTTGTATAGCAG
SQ  TGCAGCTTTTTCCTTTGTGGTGTAAATAGCAAAGCAAGCAAGAGTTCTATTACTAAACAC
SQ  AGCATG
SC  EMBL #V01380; nt 4071-4377, release 63
XX
FT  4071 - 4377(EMBL): cleavage by murine topoisomerase II
FT                     [1]
XX
SF  may have an altered conformation or ssDNA character when
SF  supercoiled [1]
XX
FF  strength equivalent to SM0000001 [1]; seems to
FF  recognize the same sites in nuclear matrices like cellular
FF  MARs [1]
XX
EV  in vitro selection of S/MAR [1]
XX
BF  SB000052; topoisomerase II [1]
MM  topoisomerase II cleavage assay; 
SO  L1210; mouse
QA  6
XX
DR  EMBL: V01380; SV40XX
XX
RN  [1]
RX  MEDLINE; 90080151 PubMed; 2152827
RA  Pommier, Y., Cockerill, P. N., Kohn, K. W., Garrard, W. T.
RT  Identification within the simian virus 40 genome of a
RT  chromosomal loop attachment site that contains
RT  topoisomerase II claevage sites
RL  J. Virol. 64:419-423 (1990)
//