S/MARt DB - S/MAR

AC  SM0000237
XX
DT  27.3.2000 18:58:36 (created); ili
DT  27.3.2000 18:58:36 (updated); ili
XX
NA  SV$MAR2
XX
OS  SV40, simian virus 40
OC  viridae; ds-DNA nonenveloped viruses; papovaviridae;
OC  polyomaviruses
XX
SZ  399 bp
XX
SQ  GAATCCATTTTGGGCAACAAACAGTGTAGCCAAGCAACTCCAGCCATCCATTCTTCTATG
SQ  TCAGCAGAGCCTGTAGAACCAAACATTATATCCATCCTATCCAAAAGATCATTAAATCTG
SQ  TTTGTTAACATTTGTTCTCTAGTTAATTGTAGGCTATCAACCCGCTTTTTAGCTAAAACA
SQ  GTATCAACAGCCTGTTGGCATATGGTTTTTTGGTTTTTGCTGTCAGCAAATATAGCAGCA
SQ  TTTGCATAATGCTTTTCATGGTACTTATAGTGGCTGGGCTGTTCTTTTTTAATACATTTT
SQ  AAACACATTTCAAAACTGTACTGAAATTCCAAGTACATCCCAAGCAATAACAACACATCA
SQ  TCACATTTTGTTTCCATTGCATACTCTGTTACAAGCTTC
SC  EMBL #V01380; nt 3610-4008, release 63
XX
FF  weaker than SV$MAR1 SM0000236 [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: V01380; SV40XX
XX
RN  [1]
RX  MEDLINE; 90080151 PubMed; 2152827
RA  Pommier, Y., Cockerill, P. N., Kohn, K. W., Garrard, W. T.
RT  Identification within the simian virus 40 genome of a
RT  chromosomal loop attachment site that contains
RT  topoisomerase II claevage sites
RL  J. Virol. 64:419-423 (1990)
//