S/MARt DB - S/MAR

AC  SM0000244
XX
DT  11.4.2000 09:28:38 (created); mfr
DT  11.4.2000 09:33:06 (updated); mfr
XX
NA  DROME$MAR7
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  2782 bp
XX
LO  1, 14B-15B
XX
SQ  AAGCTTTAAGGCTTCTCAAATACAATGCATCACTCATTCAATTAGTTGTTTCTTATTTAG
SQ  CTTTCGTAATCGCGTAATCGCAAGTACCTTTGCAGAAACATTAATTGTTCTAAATATATA
SQ  AATAACACAATTTATTCACTGTTGTTTTCCTAAAAACTATGTTTACTTCAATTTTTAATC
SQ  TGAAGGTGGGAATAAATCCTCCAAACCCAAACTATAATTCTTTCAGATAAACAGATTTAT
SQ  CTGAAACTTAAAAGCACCATAATTCCACTTTAAAATGTGATGTGAAAATTAATGATTATA
SQ  ATTAGATGTGTTGTGAAAATCATTTTTCAACGAAGTTTTTACAGAATGTACCATCAATTT
SQ  AAGTGACAAGTGCAGCAACCTTTATGCTGCCTCGATTCTATTCAACAAGGTGTCCTCAAA
SQ  TTGCTTGATTTGAGAATAATATCTGATAATATTAATGTGTGGAGTGCCTTTATAATCGAT
SQ  TCCCCATTGCTGAGTGTCACTTTTCAATTCGGCGCCGCCAACTGGCCTTTGTGAATTGAT
SQ  TGATGTGAGTTCGAAGGTGAAAAGTCAATCCTCGAAGGTTTTTTTTTTAATATTGTTTGG
SQ  AACGAATGGAAATATCTTCTCTGGGGTCATCTCGATGTCGCCCCCCCATTTTTTTTTTTT
SQ  TCATGTTGGACAGTGCTAGTCAACACTTTCGTTTTTCCTTTCTCTTCTATTGTGTAGCGA
SQ  AATGGTTTCATTAATCAAAAATTTGGAGAAATAAATGCTCGTTTCTTTCGATTTATTTCG
SQ  GCCCCCTGCCAGATTTGATAAATAATTGCTATCTTATTATGTCGATTGTCGTTGCTGTCG
SQ  CCGCTGGAATCAAAATTCAGGGACTTCAGAGTCCCACAGATCCACTGTCACCGGGCTAAA
SQ  GTCAAGAACAAGATACTGAATCGGAATCGGGCACAAAGTTCTTTATTAACACGGGAATAG
SQ  CACGGCACCCTTTGTGCACGAACACCAAAATCGAAACGTAATCGAGGTCCGAGATCCGAG
SQ  ACGAAATCGATCAATCATTTTTCACACTTTGTCGTCCAGGTTCTCATTCTCCATCCCATT
SQ  GCCATTACGATTACCATTACCATTCTCCGTCCTCTATCCTCTATCCTCATTCCCATACCC
SQ  ATACCCATACCCATCCAGATCGAACCATCAAGTGGAGGCCCTGTGGATTACAAAGATCCA
SQ  ACGACTATATGTATATATATATATATATATTCGTACATCTCATCTCTTTCTCGCCGCGTA
SQ  CTTGACTTCAGGTCAATAAATCGTTTCAGATTTTTTGTTTCGGTTCTCTTTCCTCTGATT
SQ  TCTTTAAATACGATTTACGCTGACACAAATGATATTAAAAATCCATTAATAATTTTTGAC
SQ  CCTGCATCGATTTCGATTCCGATACCCCAGCTATACTCTTTTTACCCACACAAAAAAAAA
SQ  AAAAATAAAAAAATAACGCCCTGAGCCCGAACCAGAAACCCAAGCTAAATATCAACCTGA
SQ  GTATCCGAGCATTGATACTCATATGGAACTGCAAAAGGCCATGGGAAGTTATCCAGTTCG
SQ  CTGGCTTTGCTCTCTTCAGTTCAAACAAAGGCGTCACAACATCTCACATTTAATTACATT
SQ  TTTTCAGATCAGTTTGCCTCCACGCCCCCAAGCTCCCAACCAAAAATAAAGAAAAGACAG
SQ  GACAGCTCATTAGTTTTGGACGATTTATCCGGGAAAACTCAAGCAACTGTTCATCAGTTA
SQ  TGTATATGGTAGGCAAGTTAGATCACCAAATGGTTGTTTGTCGAGTGAAGGATTTTCGAA
SQ  ACGAATCAACCTTGCACACTTAATATAATTATCCTTGGTAACCGAAAAAGTAGGGGCATT
SQ  ATAAATAATGATTGTAAATATATAGAGCTCATCTGTAAATTGTGGGTCTGTTTTTTGAGA
SQ  TCCATCCTTTTAAATTAATTGCACCTCTAACTGTTTGAAAGAAAAACAATATGAAATTGA
SQ  ATGATCGTTACCATCTTACATTTTTGAATATAAATATGTTGAATTGCTCTTCATTTTGCT
SQ  TGCAAGCATATACAATAAATAAATATTTTTAAAATGTCGATTTGCATAGTAACATTTTAT
SQ  CTCTATAGTTGCTTGACCTAACTTTAACTGATTTAACCCACGAAATTTGTTAACTGCAAC
SQ  CAAAAACATTTATTCTGTTAATACTCGTATCTTTCTATACTTTTCTGCTTAACCCAATAT
SQ  ATTTTATTTTATGGAAATTTTTTAAAAATGTATAAGTGCAGTTTTCAACAATTTCCGAAT
SQ  TTTCGGAATCTCTTATTTATCATGATTTCTTTTTAGTGATTTTCTTTTTAGATTTTTAGC
SQ  TGTCACTAAATAAGAGTTTAACATTTGATTGATTTTCAGTACTAAAAAGTCGATTAAAAG
SQ  GTCAGTTCTGTTGCGTTTTATTCCGCCGACTGTGTGAATTAGTCCTTCCTGGGTCAACCC
SQ  GCATGTAAAATACGCAGGCAGTGCGGGGATTCATTAATGCATATTGAAGTGAGGCGACGG
SQ  TCGACGTTGAAGGTGAGGTGGTGCAATTATCGCACAATCCTTCGACAATTCCTCAATGAA
SQ  TGCGTGAAATCCGCGCGGGATGTTCCGCACATGAGACATAATAATAATAATGGTAAATGG
SQ  TAGGATGGTTGATGGTAGGATGGTAGGATGGTTGATGGTGAATCGGTGGCGGTGGCTCTC
SQ  CTCGGGCCCTTGGATATTGCACAATTGCAAATCCAGGTAGGCTGGGAACTTGAAAATGGG
SQ  AACTGTGAACTGTGATACGGGG
SC  GenBank #AE003501
XX
FF  rather weak S/MAR [1]
XX
CP  0-18 hr embryos [1]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AE003501; AE003501
XX
RN  [1]
RX  MEDLINE; 90326489 PubMed; 2374707
RA  Surdej, P., Got, C., Rosset, R., Miassod, R.
RT  Supragenic loop organization: mapping in Drosophila
RT  embryos, of scaffold-associated regions on a 800 kilobase
RT  DNA continuum cloned from the 14B-15B first chromosome
RT  region
RL  Nucleic Acids Res. 18:3713-3722 (1990)
RN  [2]
RX  MEDLINE; 90377236 PubMed; 2118999
RA  Brun, C., Dang, Q., Miassod, R.
RT  Studies of an 800-kilobase DNA stretch of the Drosophila X
RT  chromosome: comapping of a subclass of scaffold-attached
RT  regions with sequences able to replicate autonomously in
RT  Saccharomyces cerevisiae.
RL  Mol. Cell. Biol. 10:5455-5463 (1990)
//