S/MARt DB - S/MAR

AC  SM0000246
XX
DT  11.4.2000 09:40:20 (created); mfr
DT  11.4.2000 09:40:20 (updated); mfr
XX
NA  DROME$MAR9
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  6427 bp
XX
LO  1, 14B-15B
XX
SQ  AAGCTTACAAATTGTCGAGTGATAAATGGTCTTAACAGGATTCTATTTATTTGCCGCTCT
SQ  GCTATGCGGCCAAAGTTACTCTTCATTACATTTTTGGCTTGGCTTGTCGTCGTTTCAACA
SQ  AGAATGGCAAGAAATGCCATCCCAGCATCACTTTATTTTGGCATAAAAGTGTACATAATT
SQ  TGACATTGACAATACACGGGGACAACAACAAGTGCGCGTGGTGGTGGTGGTGTTTTTGTT
SQ  TACGAAGGTCCTTGGAAGTCCTGAAAATCCTGAAAGTACTTTAAAATGGAACAGTAGCTG
SQ  TGGTGAAGGGGCGGCGCTCGGGCGCAAATTGATTAATTGGTTTGTGAGCGTCTAATTAAA
SQ  TAAAGCGGTTCAACGCCCGGTACCAAATAGATCCGGCTCGTGGGACCCACGTCACTGTGT
SQ  CCTGCTTTTGAGCAACAACAGCAGCCCATTTTTTTTTTTTTTTTGCTTCTTTTGTTGCTT
SQ  TTTATTAATGTGACGGCTATTTGTTTCTAGTAAGCAATTGCAAAGCAATTTTATAGCAAT
SQ  TACCTTCTTCTAACAGCTTGGGACAAGGCCTTTTAAAGCTATATTTTGCAGGGAGNNNNN
SQ  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAACTGGCCATTT
SQ  GTGTGCAATAATGCCGTGTTGGTACAACACAAAATATGAAAATAAAATATGCAGCACAAG
SQ  TGTAAATGAAATGCCAAAGGCTTCCCCACTTTCACTTCGAAAACGGGAAATTATTGCCCG
SQ  GCTCCTTGAAATATGCAACTCACCCCGCATGTTTCCATTTTCCGCCTACGTTCCTCCAAT
SQ  TTTGTAACGTAATTTTGGCCTTATTTTGGGACAGATGTGACCAGGGCATGTGCTGTGAAA
SQ  TATATCTTCTGTTTTTGGCGCTCTTTCTACACAGATTTCCGTTGTTTTTTTTTTTTTTGA
SQ  TCAGTCAACGAGAAGAACATTAGCCGCATCACCTGTAATTAAATGTTTCCCCTCAATATC
SQ  TAAGTGTTTTTATGGTTTAAGTAGTTTAAAATCACCTGTGTAAGTACGCTAATTATGTGA
SQ  CAGTATCTATTGCTTTGCATATCTCGACATACGGACAGAATACTAAACAATTTTCGTTAC
SQ  AATCATAAATCGCGACGATTCATTTAGTTGGTATGAAAGTGATAATTGCTCGTTGGTTTT
SQ  TATGGCACAACAATTAAACGTGGCGCGTATGTTTAAGAGCATATATTGGCAATGAAATGC
SQ  GCAAAAAGGTCACCGGAATGGCAAAATCCAAGCCACTTGTCTTGGCACTTTCCACAATGC
SQ  CACTTGCCACTAGCCACTTGCCACATGCCACTTGCCACTTGGCAGTCCTCATTTGTATGG
SQ  ACAGCGGCAGATTCCCTCAGGCAATGAAGGCGAAATCAGGCATTATTCATTAGTCGCCGC
SQ  CAATCGATGGCTGGCGAATAATTTTGTGGACAAACAAACGGGCCAAATACATATGTATGT
SQ  ATGTAGAGCTAGCTCTCAGAATCGAAGGAGTGAGCTGATTTTTGGGGGCAGGAGGCAAAA
SQ  AAAAAAAAAAAACATTTAAAGAGCTCTACGCCAGCTACATTTTGATCGAACTCATTCGAT
SQ  GCGGATGGGTTGGCCCTTGTCCATTGTCCATTGCCTGCTTAATTGACACACACAGAGTTT
SQ  TATCTGTGGGAAAACTAATTTCCTAGGCGTACTGTCTTCGCTGTGCGTGTGGGGTGAGTT
SQ  TCGTTTTCTACGCGAAAAACTGGGTGTTTACATTTAGAAAAAAAAAGTGTATAGCTATCT
SQ  GGAATGCGCCATAATATAAACAATGGCATTTTCAAAGCAATTGATATATATATTTAATCA
SQ  GATCAGCACTAAAAGAGATTCGCTGCAAGCAAAAACACATCCTAACCTGATTTTAAACTA
SQ  GTGACGAACGCACGTCCATGCCGTTTGATATCAAATTTGTGACGGAAGAGTACTTACTTA
SQ  TTTATTATTTCGCTTTACGAAAAAATATATCATTATCTTATATGAATGGCTAGAGCTACT
SQ  ATCGGTGTCCTTCGTCACTATGTGTACAACCGCTCAAAGGGACCTTGCACGTGTTAATGG
SQ  AAAGGAAAATACTATGATTTGTAGGTTTTAGTTAATTTGTGTCAGGATATTTTTGCCAGT
SQ  GCATGTGAGCTATGCCTGTGCCTGCTGATAAGCATTTCATGTCACATCCTTAAGGGCTTC
SQ  CACTCACTCGCACCACGCGGCAGACATCGGAGTTCACATGAGGACGACATGGAGGATATG
SQ  GAGGACATGGAGGACATGGAGGCAGTGGCTCGGGCACACCCTCCCTTTTGTCTTTACTGT
SQ  CACCGTCAGCGGCGCTTAAGATTGCTTTCAACGCTTAATTGCTTTTTTTTGTGCGATGTG
SQ  CGGAGTCCTTTTGATGTGCCAATGTGGAGAAGGCGGGCTTTTGTCATGGACCTGAACGTG
SQ  TCTCATATATATATAGTATGGTGTATAGTGCGTAGCATTTTCGCAGGAAGAACGTTATTT
SQ  CAATTTCCGCCTTGCCGTTTGCCGCTTTCCCTCCTTTTTCGGTCAAACATCCCAGACACG
SQ  CCATTATTGTTTGACGTGTCAGTGTTAATGAGTCATTGTCCATTAAGTTTGCTCATTTCA
SQ  AACGGGCAATTAAATTCGACTTTATTGCACTTCACTCGCCGACGAGATCGAACCCCAAAA
SQ  ACCGAATCGAATCGGACTAACGACTAACGACGACTCGCCATTCTGGCGAAGCGTACCGCT
SQ  CTGCGCATGGATATGGATTTGGTCGAGAATTTGGCCGGACAATAAATCAGTTTGTTTATC
SQ  TAAATTAATACCGCTGCTTTGCTATGCAGCACTTGTCATATAATGTCACATGTCACGCAA
SQ  GTCCCCAGGCAAAGCGACGCATAGTTTTTCCAGCAGCCACATAAATCAGATCGCAAGAGA
SQ  GCAAAATATGAGGCATAGTCGTCGACATAAATAATTAACAAACTCTGACACAAATGATAA
SQ  ATTTTTTTTTTTTTTTGCACACAGCACAGACGACGGAATATTTATGACAAACCAGCTACA
SQ  CCAGATACAACAACATACTCGCATATACAAAACTACACACTTGTTTCGTTACACTCGGAA
SQ  TGCCCATGGCACTTGACACTCGAGTGGCCAAAAGGCATCCTATCGTATATGCCTACTTTT
SQ  GCCTCTCTAATCAAGGACCAAGGGTTGCGATCTGCCCCTTGCCGGTGATTTACGAGCTCC
SQ  CCAATCATTCGGGACACATAGCCAAACAAGTAGATACCGTATACAAGCAACAATGGAGAA
SQ  TATATTCGTACAAGGAGCTTGGCATCATAACTCGTCATTGCATTTGATTTTATTTCGGCG
SQ  TTATTTATTTGAATTATTTATTTATCCTATTATTGGGACGTCGAACAAGTTTCGTTTTTG
SQ  CTTCCTGAGGGTGGTAATCTCATCGCTGCCATCGTATCAGTAGGGTGGAGGGTATCAGAG
SQ  TTCCAAAGTTCCAGAGATCCACGCCCCGCAAATTTGACATTACTGACCGACCGTTCCCTG
SQ  TGCATGAATATTCGTAATATTGCCCAGCATATGTCCATTTGCGTGTCCTGCGTCCTGGTC
SQ  ACAGTGCCAATCAATAATGCGGACTGGATAAAGATTTATAGGTTTTGCATTTGCCCGCCC
SQ  GGCCGCACGCACCACTCCTTCCACAATTATGCTCGCCCCACCCTCGGAAGAACCCCCCCA
SQ  CCGCCCACGCACTCCCACTCACACGGAAACCAAAGGACGAAGGATATATCTGCCATATTT
SQ  GCACCACCCATTCAGATGGGACACCGCTTTGGGACAGACTGGCCAACTGGTAATTACAAA
SQ  CAAGAATAAGTGAGCAGTTATTCATCGTGAATGTATCCGAAAGATACAAAGATACAAAGA
SQ  TACAGAGGCAAGGGCCAAACAAACTGTTTATCCCACCGAATTGTATTTATCAAATGAGCA
SQ  GTATTATTAATGAGCTGGCCAGAATGCAGAAGGTCAATCATAGGTGTTATAATACGATTC
SQ  CACTTCGCTCTTCCGGCGAAATAATACATATTTAATTTCACTCGTATTTCAACTCAGTCC
SQ  ACATTTACTTGATTTAATCAGTAAGAAGGTTTTTGGCACGTTAGTCATTGCACTTCAAGT
SQ  GTAGCGAATCAAATACCAGACCTTTAAGTTAGAAAAAAAAGAAAATATATTTTCAAGCCA
SQ  CATTAAAAAATGCTGAAAACCTTCTAAGTTTTAGCTTAAATTAAGTTATAGCTGAAATAT
SQ  AAAGCATTTGTACAAATAGAGGCATCTATAGTTTTCTTATTGAGATTTTTGTACCTGTTA
SQ  CACGAAAAGTAAAATGTTATATGTACTAGATTCGTTGAATATTATGTAAGATGTATAATT
SQ  TATATATTAAATATATAAATTTATGTTCGGATCATAAGCTGAGCCGATCTGGTCATGTCC
SQ  GACCTACAAAAACTAGAGAATTGAGATTAAGCTAGCAAATACCAATTGGCTTACAAAACC
SQ  TTATAAAAACCAGCCCCCTAACTTAAATCGAGTCCAGTAAGACAAACTTTCTTTTTATCA
SQ  AAAATCTCCTAAGAGTTCTTTAAAGTGATTTCGTGAACATGAAACTGCGAGTTACTCCAG
SQ  CGATGATTAGCTTCCTGGAGCACATCCCCATCCATCGTTGGGCGCCACTCCATCAATTAA
SQ  GGACATTCAACTTGGGCACTCCGGCGTTGACACTCTAATAGGGAAGTGGAATTTTTATAG
SQ  GTTTCTTTATGTCGTTTGTACCTTGGTTGCCTAATTACGTGCAAGTCTAGCCGGGGTAGA
SQ  CAAATAAATTTTCGGTGATTTGTTGACATGTGAATGCGGAAAGGCAGGCATTACTCTCCA
SQ  CTCTCTACGCAATAAGTAACTAGAGCGAATTTAACTATTCGGCGATTACAGTGGAAACAG
SQ  TTGTCCGCAAGGAGTGGAGAATGAATGGCTCCAAGCGTACTTTATGTCCCATCAAAGTAC
SQ  GACGCCTATGCCATAAGGTGGTCAAGATGGTTCCCCATGACGGTCCAAAATCAGTAGCAT
SQ  CCTGTTGGCGGAAGTGGCTGCGGCAGTGCCAGCCATGTGGAAAGTACTGTCGAGACCGGG
SQ  GCCATAAAGAAAAACTTCATTTATTCGGAGGGAAATAAATCTTTTAATGCACATCGGAGA
SQ  GTCGTTATTCGGGCATTGTTTTCTCATTTGCCACAACACCTCCGAATACGCCCACAAAAA
SQ  TCATGGGGCATATGTCGTGCCATTTGGCCATCGAGGTCCTCCAGCCAGCCAGGGAGCCAG
SQ  GCAGCCAGTTAGCCCGTGTTCCCCCAAAGGTAAAGGCACATCCTCAACTAAAGCATCCAG
SQ  CTCCAGCGCTCAGCTTTTGGCCAGAAAAGGCCGATTTCCCTGTCAGAGCAAATGAACGTT
SQ  GAATGGCTATTTCAATGATTCTAATTATGGAGCCGCCCGGCGCAAAAGTTTGTTAAGTAT
SQ  CGCGTGCATCATTGTTATTGTTTTTCTTGCCAAGCCCGAGATCCACAAAGCAGCCGAATT
SQ  GCCTTGTTCTTTGGATATATGTGGCTACACGAACAGCAGCGGGCAAGAAGCTAGGTGCAT
SQ  ATGATTTGGGCTCTAAAAGAAATGTCAATCAAATTGATTAGTTAATTAATATAATTTAAG
SQ  GTTTGCTTTACATTTTATACATAATACTATCGAAATGTTGCTTTCCATTTATGGTACTCC
SQ  AGTGAGATCTATTTTGTTGACCTGTGCTGTGGGAATCCATCCTCGCCTGTTACATTTCAT
SQ  TCGATGGGTGGTGTGCGCTCATTAGGTGGCCACCCCTCACTCTCACTTCCATTTCCAATT
SQ  CCAGCGCAAGTCCTTCGCTTCGCATCGTCATGCAAAATGTCCCACAAGGACGGCAATTGT
SQ  CCTGCGCTCCCGGATTCATGGGTGTGTGTGTGTGTGTGTGTGTGCATGAGTTCATGTGTG
SQ  CGTGGCTGTGACCTGTGAAAATGTCCGTGTCAAGTTGTGAGTAATAACACGGAAATGCCG
SQ  AAGGAGGAAAGGACAGCGAAGCACAGCTCGTAAAATGGACAAACACAGGACAGACAGCCG
SQ  CGTGGCTTTCTTAATCATGTAGTAGACATGGGAATACCCTGCCTAACACAAGAAACTGCA
SQ  ATTTAAGTTTTGATTTGGTATCTGTATCTTCAGATAGAGTTAGTTTATTTATTTTGGGTT
SQ  ACGAAGATAGTTTACTTGCAAACATACTTTGAAGATTATTATGTTCATAAAACTACTTGG
SQ  CTTAAAGATGGGCCTAAACGGAGTTTGGGCAAAAAAGTATGGGTTAGTCAGCTTGTATTG
SQ  CTTGTTTTAATTATTACCCTTCAATTAATTTGTGACATGACCAATATGAGTTTCGATTGA
SQ  TGTAATCAAACCTCTTGACAAATCGCCCTACACCATTGGCAACTACATCTGCCGATTTTC
SQ  GCCGACA
SC  GenBank #AE003501
XX
CP  0-18 hr embryos [1]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AE003501; AE003501
XX
RN  [1]
RX  MEDLINE; 90326489 PubMed; 2374707
RA  Surdej, P., Got, C., Rosset, R., Miassod, R.
RT  Supragenic loop organization: mapping in Drosophila
RT  embryos, of scaffold-associated regions on a 800 kilobase
RT  DNA continuum cloned from the 14B-15B first chromosome
RT  region
RL  Nucleic Acids Res. 18:3713-3722 (1990)
//