S/MARt DB - S/MAR

AC  SM0000266
XX
DT  11.4.2000 10:52:49 (created); mfr
DT  11.4.2000 19:04:36 (updated); ili
XX
NA  DROME$MAR29
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  1913 bp
XX
LO  1, 14B-15B
DE  G001729; rudimentary
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; 
XX
SQ  GAATTCAGCCTAGACAAAACAAAGCAGCGCTATTGTGGCTCTTTCTTTCTTTTAAGCACT
SQ  TTTAGCCAACAGAAATAAAAACACGAGGGCTTTATGTGTGTGCATCTGGCTGTATGTATG
SQ  TGTGTGGCAACCACAAGGAATTTTCTGTTGAGGCACTTTTGTTGTTTAGTTTAGATCGCG
SQ  TTGCTCTGGTTTTTTTTTTTTTACTCAAATCTCAAGTGTGAGAAAAACAGCAGGCGCACC
SQ  ACACACAAACACACACACACATGCATGCACATATCGGATGTTTAACATTTAAATTAGCTG
SQ  CTTCTGATTGGCATTTTCGGTATGACACTGCTTGCATTCAGTTCTTTATGTGTGGGTGTG
SQ  TGTGTGTGTGTGCCTTTGACGTTTTTATTGCCTAATCACTTTTTTTTATTTGCACTTTAC
SQ  TACGAGAATACTGGACGAAAACCGCTGACTGGAACTATTTTTATGTTTGCCCCATAATGT
SQ  TTTTCAACCGAAAAATTGTATATTTTTTTTTTACGTCTAGTGTAAACAATTGAAATTTAT
SQ  TTACTTCAGGGCATAAACAAAATCGTTATACACACACATTGATAGGCGGAAACAATCAAA
SQ  TTGATCATCGAAAGTTCAACGATACGCAGCGATCAAGGTTAAATGGTTCAAAATGAAAGC
SQ  GCGCTAAAATAAAAAAAAAAGGATAAAACGGTGCGCGCGCGCACACACACACACACACGC
SQ  ATGTGCATTTGTCAATGCAAGCAGTGCAGTTGTCCTGCATCCTGTTTAGAAACTCCAAGT
SQ  TTGAGATGTATTCCCCCTCCCAATTACAAACGTATTTTTATGTATTTTAGCTCTTGAAAA
SQ  CGCAGAAACTACAATGCAGTACAATTATTATTTCTCATAAGATTTATTTAATTTTTTTTT
SQ  TTGTAATTAACTAATATTAATTTATTGCTCAAGTTACGATGGCACGTTCAACGTGCTTGA
SQ  GTGACAATTGTATTATGTAGTAGAACTTCCAAAGTGTTCAGGCCAAAAGTAATTCTCCNN
SQ  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTATGTAGCT
SQ  TATTTAGTTATCTTGATCTAAGCAACGAATCGAATATGAAATTATCGAATGACTGAGACA
SQ  AAGGCAGCGAATACTTTATACCAACATAGATTTTACATTTTGATACTAACTAACTATTAA
SQ  CTATTGACTATTGTATATAAACGTATTTTGTACACACCATATTGGCTAAGCAATTGATAT
SQ  AAAAAATATATATATATATGTACATTTAAATGAAAATGTGCATAAACAACGATTGTTAAC
SQ  TCGAACTCCACAACGAATAGCCACTAAGTCTTAGTCCTTATACACACCAGATAGCAGATA
SQ  TTAATATTAACTAAATCTAAATCTTTAAAACTAAATCACTAAAACAATCGAACAAGTCTG
SQ  CAAGGCAAAATGCCCACTAAGTCAGCTGCTCCACGCCCTCAAAAGCCAATTTCGAACGAT
SQ  TTCCAACGAGAGGAAGAGTATTTTAACGTTAATTATCATATAATGTATGGCATTCGTAAG
SQ  GAGGAATATATCAATAAATCGCTTTTGGAGGCCTCCCTCCGCATGCCCCTCCATCCGACG
SQ  CCTCTGTTTGCTATTAATTTATGGCGTCGAGCGGGAACATTTTATAGATAAACATGCGGA
SQ  ACAAAATTGTCTGAAATGGCAATTAAATGAAACCGAAACTGAAACTTGGCATTAATGTGC
SQ  AGCAATGTACATGCATAGATATATAGGATAGATATACACAAGATACCCCGATATTCACAA
SQ  ACAATACACCCGCAATAGTATACACAATAAACACGAATAACGATGTCAGCAAATGGGTAT
SQ  TGCCATTGAGCAAACTACTACTAAACTATTTATATTTACATAGCGTACAATAA
SC  GenBank #AE003503
XX
FF  displays ARS activity in yeast [2]
XX
CP  0-18 hr embryos [1]
XX
EV  in vitro selection of S/MAR [2]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AE003503; AE003503
XX
RN  [1]
RX  MEDLINE; 90326489 PubMed; 2374707
RA  Surdej, P., Got, C., Rosset, R., Miassod, R.
RT  Supragenic loop organization: mapping in Drosophila
RT  embryos, of scaffold-associated regions on a 800 kilobase
RT  DNA continuum cloned from the 14B-15B first chromosome
RT  region
RL  Nucleic Acids Res. 18:3713-3722 (1990)
RN  [2]
RX  MEDLINE; 90377236 PubMed; 2118999
RA  Brun, C., Dang, Q., Miassod, R.
RT  Studies of an 800-kilobase DNA stretch of the Drosophila X
RT  chromosome: comapping of a subclass of scaffold-attached
RT  regions with sequences able to replicate autonomously in
RT  Saccharomyces cerevisiae.
RL  Mol. Cell. Biol. 10:5455-5463 (1990)
//