S/MARt DB - S/MAR

AC  SM0000299
XX
DT  13.4.2000 18:02:57 (created); ili
DT  14.4.2000 10:09:32 (updated); ili
XX
NA  MOUSE$MAR2
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  382 bp
XX
SQ  GATTTTTTTTTTTTTAAATAAAGACAAAAGGAAGGTGCTGTGGCTCAGGAGTTAAGGCAC
SQ  TGGTATCACGCCTGGTATTCAGTCCCAGAACCCAACTGCTGAAGATTGTCCTCTGTCACC
SQ  ACAAGGGAACCATATAAATAAATACATCGAAATAAATAATACACAAAAATAAGTATCTTT
SQ  TTGGTAATTATCAGAGAGACTGCTCTGTAATTAAAGGATGCACTACACGCCTTTAATCCC
SQ  AGACTTGGGAGGCAGAGGCAGGTGGATTTCTGAATTTGAGGCCAGTCTGGTCTAAAGAGT
SQ  GTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACAAAAAGAAT
SQ  ACAAAATTTTTAAAAAAGTGCA
SC  EMBL #X64490
XX
SF  shows some homology to B1 repetitive sequences [1]
XX
FF  found attached to the nuclear lamina [1]
XX
EV  UV-crosslinking [1]
XX
DR  EMBL: X64490; MMNLAM2
XX
RN  [1]
RX  MEDLINE; 93000484 PubMed; 1339329
RA  Christova, R., Bach, I., Galcheva-Gargova, Z.
RT  Sequences of DNA fragments contacting the nuclear lamina in
RT  vivo
RL  DNA Cell Biol. 11:627-636 (1992)
//