S/MARt DB - S/MAR

AC  SM0000315
XX
DT  13.4.2000 18:58:53 (created); ili
DT  13.4.2000 18:58:53 (updated); ili
XX
NA  MOUSE$MAR18
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  334 bp
XX
SQ  TTTACATATCTAAGGTTAATCATAGGCATAAAAGATGTTTAAATGACTGAATCCTTTCAA
SQ  AAAAAACAAACAAGCAAGCCAGCACACCACAGCCCTGTATTTGGCGCATTCACAGCAGCC
SQ  AAAGACTTAGTGTGTTTCCCAGCCCCTGGCCAAGAGCTAGACTTTCCAGACACCCCATAA
SQ  ATGCTCTCTCTGGCTTCGACTGTTTGAGCTGTCTGTGGCACACTAGGAGCAGGGCTTTTC
SQ  CACGGGTATTACTAAATCAAAGGGGAAATGCCATGATCTGGATGCATATTACGAGAGCTT
SQ  TCTATTCCGCTCCACTCCCGTGTGAGCCATCATG
SC  EMBL #X64506
XX
FF  found attached to the nuclear lamina [1]
XX
EV  UV-crosslinking [1]
XX
DR  EMBL: X64506; MMNLAM18
XX
RN  [1]
RX  MEDLINE; 93000484 PubMed; 1339329
RA  Christova, R., Bach, I., Galcheva-Gargova, Z.
RT  Sequences of DNA fragments contacting the nuclear lamina in
RT  vivo
RL  DNA Cell Biol. 11:627-636 (1992)
//