S/MARt DB - S/MAR

AC  SM0000325
XX
DT  28.8.2000 19:10:28 (created); ili
DT  23.3.2004 11:04:00 (updated); ili2
XX
NA  EBV$MAR
XX
OS  EBV, Epstein-Barr virus
OC  viridae; ds-DNA enveloped viruses; herpesviridae;
OC  gammaherpesviridae
XX
SZ  5153 bp
XX
SQ  CTGCAGACCCTGCGCTCCATGAACATGTACCCGGCAGTCCTCGGTCGAGTGGGCGAGCAA
SQ  GGTCCAGATCAAATGTTTGAGGTGCAGCACGGCCCAGAGACGGTGTTGCGCCAGTCGCTG
SQ  CGCCTGCTGCTGGGAACCTGGTCATCCTTTGCCAGCGAGCAGTACGAGTGCCTGCGACCA
SQ  GATCGGATTAACCGGTCCATGCACGTGTCCGACTACGGCTATAACGAAGCACTGGCAGTC
SQ  TCCCCGTTGACAGGAAAGAATCTCAGCCCACGCCGGTTGGTGACAGAGCCTGACCCACGA
SQ  TGTCAGGTGGCCGTGCTATGCGCCCCGGGCACCAGGGGCCATGAAAGCCTCCTGGCGGCC
SQ  TTCACGAATGCCGGATGCCTGTGCCGACGGGTGTTCTTTCGCGAGGTTAGGGACAACACG
SQ  TTCCTCGACAAGTACGTGGGTCTGGCCATCGGAGGAGTTCATGGGGCCAGGGACTCTGCC
SQ  CTGGCAGGCCGTGCCACCGTGGCGCTGATTAATCGTTTCCCCGCCCTGCGTGACGCTATT
SQ  CTAAAGTTCCTCAACAGGCCAGATACGTTCTCGGTGGCCTTGGGGGAGCTGGGGGTGCAA
SQ  GTTTTGGCTGGCCTGGGGGCCGTGGGGTCAACAGATAATCCACCCGCCCCTGGCGTGGAA
SQ  GTTAATGTCCAGAGATCACCTCTGATTCTGGCCCCCAACGCCTCTGGCATGTTTGAGTCC
SQ  CGCTGGCTGAACATTAGCATCCCGGCGACCACCAGCTCTGTCATGCTGCGTGGCCTCCGG
SQ  GGCTGCGTCCTGCCTTGTTGGGTGCAAGGCTCGTGCCTGGGCCTGCAATTTACTAACCTC
SQ  GGGATGCCATATGTTTTGCAGAATGCCCACCAGATCGCCTGCCACTTCCACAGCAATGGC
SQ  ACGGATGCCTGGCGCTTTGCTATGAATTATCCAAGAAACCCCACGGAGCAGGGCAACATT
SQ  GCAGGGCTCTGTTCACGCGATGGTCGTCATCTGGCTCTCCTGTGTGACCCCTCACTTTGT
SQ  ACAGACTTTTGGCAATGGGAGCACATTCCCCCCGCCTTTGGGCACCCCACGGGGTGCTCC
SQ  CCCTGGACACTTATGTTTCAAGCAGCTCACCTATGGTCACTCAGGCACGGTCGCCCCTCC
SQ  GAGTGACCAGTCACCTTCCAGACTATGCATACACTGAATTTAGCCTGATATTGTCCCCCT
SQ  AGCCCCGGGCCCAGCCCTCCTCAGAAAACTCTGCATGGAGAAGCTGGACGTGAACCTCCC
SQ  CCCCAGACCTGTGTGCTGTATTTACAAACACTACAATAAACCCAATGTGCAAATGTGGTT
SQ  TGTATGGCTACTTTGTGTTCCTAAAAAATGCAACAATAGAAGTGGAAACCCTCAGTCACG
SQ  GGACATTAACCTCAACCACAAAATGGGGGTTGGAGAAAGTAACCACATATACTGGAGATG
SQ  ATTCATGGGCTGGGGGTTCCCGGACAATACACCCATCTGGAGTTCAACCTAATTACATGG
SQ  TAGATAAATTAAGAGTCCCTCCTCACCACTCGAAACTATGGCAGACATTCTATAAGATAA
SQ  CGAGGAGAGATGAGGTGAGGGCAGAGGACATTGGGCAGGTGTGGGCCACGGGGCAGCTGG
SQ  CCATATCCCCCGCACTACAGAAGTGTAAGCAAAGTGAAGGGCTCGGAAGGCAGGCGGGGC
SQ  CTAGCAATGTCACAGCTAAATGCCCACCAGGGCACACACTCAAGCGGGGTCTCGGAGCTC
SQ  CTAGGTCAGACCACGAAAGGTCAGCCTGCAAGGTGGATGGCGTGTTTTCTGAGGTTATCC
SQ  CCGCTACGTGCAGTGCTGGGTGATAGAGACCCTAGAATGTGTCGAAATGACCAAGCGTCC
SQ  CCGCAGCGGGGCTCCCAACACGGGTTCCCAGAGAGGGTAAAAGAGGGGGCCATAAAGCCC
SQ  AGGGTGTAAAACACCGACCGCGCCACCAGATGGCACACGTGGGGGAAATGAGGGTTAGCA
SQ  TAGGCAACCCCCGCCTACACACCAACTATAGCAAACCCCGCCCCGTCACGGTGACGTAGT
SQ  CTGTCTTGAGGAGATGTAGACTTGTAGACACTGCAAAACCTCAGGACCTACGCTGCCCTA
SQ  GAGGTTTTGCTAGGGAGGAGACGTGTGTGGCTGTAGCCACCCGTCCCGGGTACAAGTCCC
SQ  GGGTGGTGAGGACGGTGTCTGTGGTTGTCTTCCCAGACTCTGCTTTCTGCCGTCTTCGGT
SQ  CAAGTACCAGCTGGTGGTCCGCATGTTTTGATCCAAACTTTTGTTTTAGGATTTATGCAT
SQ  CCATTATCCCGCAGTTCCACCTAAACGGGGCTTAACGTTGCATCCCAGAAGATGCACGCT
SQ  TAACCCCGCCTACAACCGTGACGTAGCTGTTTACCAGCATGTATAGAGTTACGGTTCGCT
SQ  ACATCAAACAGGACAGCCGTTGCCCTAGTGGTTTCGGACACACCGCCAACGCTCAGTGCG
SQ  GTGCTACCGACCCGAGGTCAAGTCCCGGGGGAGGAGAAGAGAGGCTTCCCGCCTAGAGCA
SQ  TTTGCAAGTCAGGATTCTCTAATCCCTCTGGGAGAAGGGTATTCGGCTTGTCCGCTATTT
SQ  TTTTGTGGCTAGTTTTGCACCCACAACATGTAAGGGCCCGCTACCCCTACAACACAAAAC
SQ  AAACTATCTCCCCTAACCATCCTTTTGCCAATCAATTCTGTGACAGGGTTTCCTGGACAC
SQ  CCAGTCTTAGTTCAGGTAGACACCCAGTTATGCAGTGCCACCAATTCCAACCATTTTTAA
SQ  ACCTCCTGGAATTCTATCATTAAACGGCATGCAGGAAAAGGACAAGCAGCGAAAATTCAC
SQ  GCCCCCTTGGGAGGTGGCGGCATATGCAAAGGATAGCACTCCCACTCTACTACTGGGTAT
SQ  CATATGCTGACTGTATATGCATGAGGATAGCATATGCTACCCGGATACAGATTAGGATAG
SQ  CATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAG
SQ  CCTATGCTACCCAGATATAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAG
SQ  CATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAGATTAGGATAG
SQ  CATATGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGTATA
SQ  TGCTACCCAGATATAAATTAGGATAGCATATACTACCCTAATCTCTATTAGGATAGCATA
SQ  TGCTACCCGGATACAGATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATA
SQ  TGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAAATTAGGATAGCATA
SQ  TACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTA
SQ  TGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGTATATGCT
SQ  ACCCATGGCAACATTAGCCCACCGTGCTCTCAGCGACCTCGTGAATATGAGGACCAACAA
SQ  CCCTGTGCTTGGCGCTCAGGCGCAAGTGTGTGTAATTTGTCCTCCAGATCGCAGCAATCG
SQ  CGCCCCTATCTTGGCCCGCCCACCTACTTATGCAGGTATTCCCCGGGGTGCCATTAGTGG
SQ  TTTTGTGGGCAAGTGGTTTGACCGCAGTGGTTAGCGGGGTTACAATCAGCCAAGTTATTA
SQ  CACCCTTATTTTACAGTCCAAAACCGCAGGGCGGCGTGTGGGGGCTGACGCGTGCCCCCA
SQ  CTCCACAATTTCAAAAAAAAGAGTGGCCACTTGTCTTTGTTTATGGGCCCCATTGGCGTG
SQ  GAGCCCCGTTTAATTTTCGGGGGTGTTAGAGACAACCAGTGGAGTCCGCTGCTGTCGGCG
SQ  TCCACTCTCTTTCCCCTTGTTACAAATAGAGTGTAACAACATGGTTCACCTGTCTTGGTC
SQ  CCTGCCTGGGACACATCTTAATAACCCCAGTATCATATTGCACTAGGATTATGTGTTGCC
SQ  CATAGCCATAAATTCGTGTGAGATGGACATCCAGTCTTTACGGCTTGTCCCCACCCCATG
SQ  GATTTCTATTGTTAAAGATATTCAGAATGTTTCATTCCTACACTAGTATTTATTGCCCAA
SQ  GGGGTTTGTGAGGGTTATATTGGTGTCATAGCACAATGCCACCACTGAACCCCCCGTCCA
SQ  AATTTTATTCTGGGGGCGTCACCTGAAACCTTGTTTTCGAGCACCTCACATACACCTTAC
SQ  TGTTCACAACTCAGCAGTTATTCTATTAGCTAAACGAAGGAGAATGAAGAAGCAGGCGAA
SQ  GATTCAGGAGAGTTCACTGCCCGCTCCTTGATCTTCAGCCACTGCCCTTGTGACTAAAAT
SQ  GGTTCACTACCCTCGTGGAATCCTGACCCCATGTAAATAAAACCGTGACAGCTCATGGGG
SQ  TGGGAGATATCGCTGTTCCTTAGGACCCTTTTACTAACCCTAATTCGATAGCATATGCTT
SQ  CCCGTTGGGTAACATATGCTATTGAATTAGGGTTAGTCTGGATAGTATATACTACTACCC
SQ  GGGAAGCATATGCTACCCGTTTAGGGTTAACAAGGGGGCCTTATAAACACTATTGCTAAT
SQ  GCCCTCTTGAGGGTCCGCTTATCGGTAGCTACACAGGCCCCTCTGATTGACGTTGGTGTA
SQ  GCCTCCCGTAGTCTTCCTGGGCCCCTGGGAGGTACATGTCCCCCAGCATTGGTGTAAGAG
SQ  CTTCAGCCAAGAGTTACACATAAAGGCAATGTTGTGTTGCAGTCCACAGACTGCAAAGTC
SQ  TGCTCCAGGATGAAAGCCACTCAGTGTTGGCAAATGTGCACATCCATTTATAAGGATGTC
SQ  AACTACAGTCAGAGAACCCCTTTGTGTTTGGTCCCCCCCCGTGTCACATGTGGAACAGGG
SQ  CCCAGTTGGCAAGTTGTACCAACCAACTGAAGGGATTACATGCACTGCCCCGCGGGAAAT
SQ  ACGTCCTACCCAGGAACCCGAAACAGTGTTTCCCAGAAGCTGTAAAAATAGAACGCCCTG
SQ  GAACTGCCCCACTGTGCAATGCAGCTTTTAGCCATGCCATGCTCTATAAATCACTTCCCT
SQ  ATCTCAGGTAGGCCTGCACACCTTAGGTATGGAGCGAAGGTTAGTGGTCACTC
SC  EMBL #V01555; nt 4547-9699, release 63
XX
FT  4948 - 7337(EMBL): important for retention of EBV-based
FT                     episomes [2]
FT  6160 - 9699(EMBL): strongly attached region [1]
FT  6400 - 8300(EMBL): very high senitivity to micrococcal
FT                     nuclease [2]
FT  6629 - 7128(EMBL): EBER genes [1]
FT  7315 - 9312(EMBL): oriP [1]
XX
BP  more than 80% [1]
XX
FF  episomes containing the whole MAR are retained more
FF  efficiently in the absence of selective pressure [2]
XX
EV  in vivo selection/LIS [1]
EV  in vivo selection/high salt [1]
XX
DR  EMBL: V01555; EBV
XX
RN  [1]
RX  MEDLINE; 92192005 PubMed; 1312463
RA  Jankelevich, S., Kolman, J. L., Bodnar, J. W., Miller, G.
RT  A nuclear matrix attachment region organizes the Epstein -
RT  Barr viral plasmid in Raji cells into a single DNA domain
RL  EMBO J. 11:1165-1176 (1992)
RN  [2]
RX  MEDLINE; 21488697 PubMed; 11602767
RA  White, R. E., Wade-Martins, R., James, M. R.
RT  Sequences adjacent to oriP improve the persistence of
RT  Epstein-Barr virus-based episomes in B cells
RL  J. Virol. 75:11249-11252 (2001)
//