S/MARt DB - S/MAR

AC  SM0000338
XX
DT  4.9.2000 14:37:22 (created); ili
DT  4.9.2000 14:37:22 (updated); ili
XX
NA  MOUSE$TCRBL-MAR
XX
SY  MAR beta, 
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  173 bp
XX
SQ  TCGGTTCTCTTGCATTTATTTCTTTAGTGCTTCTTCCAAACTTACCAAGTCTCAACAAGA
SQ  TTCTAATTCTGTAGTCCATTATATTTATCCCTCTATCCTCACACTCTCTCAGATGGGATC
SQ  ATGTCGCCTTATTTAATCTTATACAAGTGATTCACAAAATCACAGCAAGATCT
SC  [1]
XX
FT  1 - 173: DNase I hypersensitive site [1]
FT  75 - 111: putative SATB 1 binding [1]
FT  150 - 164: putative Cux/CDP binding [1]
XX
FF  appears to repress the transcriptional activity of the beta
FF  enhancer in reporter gene assays, but is supposed not to be
FF  required for transcription and demethylation under
FF  physiological conditions [1]
XX
EV  in vitro selection of S/MAR [1]
XX
BF  SB000001; SATB1 [1]
MM  supershift (antibody binding); 
SO  thymocyte; mouse
QA  6
BF  SB000001; SATB1 [1]
MM  gel shift competition; 
SO  thymocyte; mouse
QA  6
BF  SB000025; CDP [1]
MM  direct gel shift; 
SO  purified protein; mouse
QA  6
BF  SB000025; CDP [1]
MM  supershift (antibody binding); 
SO  thymocyte; mouse
QA  6
BF  SB000025; CDP [1]
MM  gel shift competition; 
SO  thymocyte; mouse
QA  6
BF  SB000067; SMAR1 [2]
MM  direct gel shift; 
SO  rec(mouse-E.coli); mouse
QA  6
BF  SB000067; SMAR1 [2]
MM  gel shift competition; 
SO  rec(mouse-E.coli); mouse
QA  6
BF  SB000067; SMAR1 [2]
MM  southwestern blotting; 
SO  rec(mouse-); mouse
QA  6
XX
RN  [1]
RX  MEDLINE; 99009101 PubMed; 9792700
RA  Chattopadhyay, S., Whitehurst, C. E., Chen, J.
RT  A nuclear matrix attachment region upstream of the T cell
RT  receptor beta gene enhancer binds Cux/CDP and SATB1 and
RT  modulates enhancer-dependent reporter gene expression but
RT  not endogenous gene expression
RL  J. Biol. Chem. 273:29838-29846 (1998)
RN  [2]
RX  MEDLINE; 20408892 PubMed; 10950932
RA  Chattopadhyay, S., Kaul, R., Charest, A., Housman, D.,
RA  Chen, J.
RT  SMAR1, a novel, alternatively spliced gene product, binds
RT  the scaffold/matrix-associated region at the T cell
RT  receptor beta locus
RL  Genomics 68:93-96 (2000)
//