S/MARt DB - S/MAR

AC  SM0000340
XX
DT  23.7.2001 11:27:14 (created); ili
DT  23.7.2001 14:45:00 (updated); ili
XX
NA  WB$WCI3B-5MAR
XX
SY  WCl-3b MAR, 
XX
OS  winged bean, Psophocarpus tetragonolobus
OC  Eukaryota; Viridiplantae; Streptophyta; Embryophyta;
OC  Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons;
OC  core eudicots; Rosidae; eurosids I; Fabales; Fabaceae;
OC  Papilionoideae; Psophocarpus
XX
SZ  1897 bp
XX
DE  G002567; chymotrypsin inhibitor 3b
DP  Direction: 5'; 1897 - 1; Pos 1: transcriptional start
DN  Internal: n; 
DC  overlaps with promoter [1]
XX
SQ  AAGCTTATCGATGTAGGGACGAGAAAGCTAAGTTTGGACACTCGTGGGATCTAGCTCATA
SQ  GCACAATTCACGTTCATACATCAATTGTGTTTATTTAAACAATTTAAAAATAACGTAAAT
SQ  CATGGACGGGTTTTTGTGCCTGTCATATATTATTTTATGTAAATTATAATTTATACAATC
SQ  ATAATAATAAAATTAAATTTATCAATTCATATCAAAATTTAAACAGTTTTTATTGATGTA
SQ  TCAATTTTATGTAATTTTGTTTATTATTTTATTTTATACGAAATACTGCAAGATAGCTAT
SQ  ATCATCATACATGATAAGATATCATAAGTATATTTAATTTTTTATGTTCATGAAATACTG
SQ  AGAATTTTCGCAACTTTTATAGAGCTTGATTGATTTGATTTTAATTTTTAATTTTTAAAA
SQ  AATGTTTTTAAAAATAGTTTTAAAAATTATTTTTGAAAAACAATAAATAAAAAACTTGTT
SQ  TGATAAGTGTTATTTGAAAAATATTTTAAAGATATAAAAATGAAAAAATTTGTTCATATT
SQ  TATTAAAATTTTATTAATGAAAGTAAAAAACAACATATTATAATTGTATTTTGAGTTTTC
SQ  AAAAGAAAAATAAAAAACTGAAAAACAAAATGACTTTTAGTTGTTCCTGTTTTTGAGTTT
SQ  TTAAAAACTAGAACGGTTGTCGAAAACTATTTTTAGAAAACACTATTTAAACAAGTTTTT
SQ  TAGTTTTGAAATATTAAAAACAGTTTTATATAACTGTTGTCAATTTTCATATCACAATAG
SQ  ATAGTCAATTTCTCTCAAGAATTTACTCAATAAGGATGATATCTCTCCACCTTTCTCAAT
SQ  AAGAACATTTTTACAATTATTTAAAATATAAAAAATTATTATTAAATGTCAAAAGATTCA
SQ  ATTTTCGTATCTCCTTTCTTTCTTTTCTAATTAAAAAATATGAGTCACGCTTTATTTTTT
SQ  TTATTTATTATGTAAGTCATAAATGATAAAGCATTTTTTATTAATGGAACAAAAATGCAA
SQ  GATTTTTTCGTCTATATTATATGCCCATCTACATTTTATTTTTTCTATCTATTATTTTTT
SQ  TTCTATAATTCTATCTTATATTAATTATTATATTAATAAATATTTTCTCTCTTGTGATGT
SQ  CTAATAACATGTTTAGGTGTCCTAAAATTTTTTAATAAATATATCAAGTTCACGTACAGT
SQ  ATATTTAAACTACCTAGATATTTATTGAAATTTATTTTTGGCAATCTCTTTATTTTATTT
SQ  TTGGTAAAGTCTTTCTTTCTTCTGGATTTTCCATTGAGTTTTGGTACGTTTTATATTTTG
SQ  TTCATCTCCATTATGAGTGGAGTCATTTGGTTTGTGTCACGACTATATTTATCAGTACAT
SQ  GCATTGGCTAGATTGACGGTATATTATGTCATGACTTGAGTCTTGAGGCTTGTTGGTTGT
SQ  GTATTACGTTTCATGGGTACACGTATAGATAAGATTTGAAGGCCAATTTTGTTGTGAACG
SQ  ATAAAAGGGTATCTCTATATGCATAAAATAGCTTTAATAACTGTTTTCCTAGAAAATAGC
SQ  ATTTTAGACTTTTTGTTTTATGTTAGTGTTTAAACATGTTTATTTTATTTTAGTTCTATG
SQ  AGCTGCTGTAATTTTTCATGTAATGCAAAGGAGTCTTAAACATTAGAGGATAAACTGGTA
SQ  TAATTTTCTTTTTTCTATAAATTATATTTTAATCACTTATAAGCTAGTTTCATGTCTAAA
SQ  TTATAATGCATTAATAAGAAATTAAAAACAAAGTTTTGTCTAAAAATTTATACCAGACTA
SQ  TTTACAAATTCGTTTAATTAATAATGTTATCGAAAACACAGTTTATAGTTAACGAGCACT
SQ  TCTATAAATAGTCTACATTCGGCGAAACCTATTCTCT
SC  EMBL #D13976; nt 1-1897
XX
SF  contains regions of intrinsically curved DNA and regions
SF  with base-unpairing propensity [1]
XX
BP  strong [1]
XX
EV  in vitro selection of S/MAR [1]
XX
BF  SB000068; AHM1 [2]
MM  Southwestern blotting / filter binding; 
SO  rec(wheat-E. coli); wheat
QA  6
XX
DR  EMBL: D13976; PTWCI3B
XX
RN  [1]
RA  Minami, M., Morisawa, G., Hayashi, M., Sakata, Y., Habu,
RA  Y., Iwabuchi, M., Meshi, T.
RT  High affinity of the 5'-upstream region of a winged bean
RT  chymotrypsin inhibitor gene for nuclear matrix
RL  Plant Cell Physiol. 40:109-113 (1999)
RN  [2]
RX  MEDLINE; 20496822 PubMed; 11041885
RA  Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi,
RA  M., Meshi, T.
RT  AHM1, a novel type of nuclear matrix-localized, MAR binding
RT  protein with a single AT hook and a J
RT  domain-homologous region
RL  Plant Cell 12:1903-1916 (2000)
//