S/MARt DB - S/MAR

AC  SM0000346
XX
DT  1.8.2001 16:14:38 (created); ili
DT  7.3.2002 17:22:00 (updated); ili
XX
NA  SBI$ADH-5MAR
XX
SY  SBI$110K5-MAR4, p5sMARd, 
XX
OS  Sorghum bicolor
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  2267 bp
XX
LO  J
DE  G001340; open reading frame
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G002584; alcohol dehydrogenase
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001340;
open reading frame
G002584;
alcohol dehydrogenase

XX
SQ  TCTAGATGAAGCTGAGCTGTTTTGGAGAAAGTATTTGGCAAAATAGCTTCACCAACTACT
SQ  TCATGCATAGTTGAGAGAGAGAAATAAGGGAGAAGCTGCAATAAGCTACTTTTTTTCAGC
SQ  TTCATCTAACTTATGTCTTTGTGAGAGGAGAGGAAAACAGCTTCACCCATAAAGCTGTTT
SQ  TGAAAATAAGTGTTTGGCAAAAAAAAAACAGCTCACAACAGCTCAGGAAGCTGTTGTGAG
SQ  CTGTACCAAACAGGACCTAAATTCTAACTTCCCACATCCAAAAAGAAAACGCCTAGAGAT
SQ  ATTACCTTGAACAGCGTTTTGAACATCCATTCAGAGCCCCTAAAGGCGTCCCCAACACTG
SQ  CAAACCCCCAACATCCACATAACCACCGAGGCTCTATGTCATGCGTGTTAGTTGCTTCGC
SQ  AGACGTGCAGAGTAGGGCGCCAATAGCCTTCTCTTACAAATCACAGAAATATTTAAACAA
SQ  ACCTGCATTGTGAGTTTGTGACAAACTAGTACGCGGTTGGGAAGAGGATGCTGAGTGAAT
SQ  AAAAACGACATGCATATGCATGTTTCAGATGAAAAACATCATCGTTTCCAAGGATAGAAG
SQ  TCCAGTATCTTCATCTCATGCATGTTTAGATGGAGAGTAACTTTTTACCAAGGCCAGTAG
SQ  AAACATACACCTTCGTTACTCGTTAGTGGTGTACTGGTGTTCTAAGATCAGCGCCAACGC
SQ  ACAGTGGCGGACCCAGGAATTGGGAGCAAGGTATGCCTATGGTAAAAAAAATTTGGATGA
SQ  ACAACACAAAATATTTAGATCTGCTTAGATAAAAGATACATATAGTTCAAATGCATTGCA
SQ  TATCTGTAAATTTTATTTTGCAATTGAAAATGACATTTAATAGAACCAACAAAGGGAAAA
SQ  GGAAAGGGATTTAAGTTTTATTACTCCAAGCAAAGGGGGCGTCGTGGCCGATTGGCCGCG
SQ  CGGGGACGCCCGATGCCGGGGAGCGTACCGCCGAAGCGGCAGCGCGGGGACGCCGGCAAA
SQ  TCAAGCATCCGCACAGGACGCAGCGCCTACCTGCGCGTCTGTGGCGAATCACGAGCGGCG
SQ  GCGCGCGGTGAAAGCGGCGGCGAGCGGTTGAGAGTCGCGGAAGTGCCTGCCCGCGCGTCA
SQ  GTGCGCGGCTGCCCTACCCCTACGGACTAGGCCTGATGGTTTTAGGATTTTGGGGGAGTG
SQ  GAAAAGTGAGTGGGAAGGTTAGATGAGTCATGGACCGTTTGGATTCGCGTGGCTTATGGG
SQ  GCTGCTTTTGAGTTAGAGGTGAATTGCTGAATAAAATGACCTAGAAACACAGAAAACGTA
SQ  GTTTTAACACCTTATGCATATTATATATGTATATATCTCAAATATCTATTAAATTTTTTT
SQ  CCAAAAATGTAGGGTATATCCGGGAATACCCGAGCACAACTGTAGGTCCGTCTATGCCAA
SQ  CGCACAAACTCAACTTGTAGGCCTAGCTTGCTAGCTATATTTGGATGTCACGCTGTTCTA
SQ  AATTCATATGCCTTAAAATTGATATAAGTCAAAGGCTACTATTTCCTCAAAAGAGAGAAA
SQ  ATGACATGTGCGTACGTGAGACGGGAATTAGAGGTTGTGTCCGCTTTAGCTTCTTTCTGA
SQ  CAAATGCTGTAACGTCTTTGTTTGCAACTGTGCGTGCAGCCGTGAGCTTCTTTAGCTTTG
SQ  GTTCTGACATAATGCCACAGGGCGTCTATAGGCGTTGTTTAAATACATCAAAAACCCAAA
SQ  ACTTTACAAGATTTTCCATCGCATCGAATTTTACAGCATATGCATAAAACATTAAATATA
SQ  GATAAAAAATAATTAATTAAACAGTTTACCTGTAAATCACGAAACGAGTTTTTAAGCCTA
SQ  GTTACTTCACGATTGAATAATGTTTGTCAAATAAAAACGAAAATGCTACAGCCATAATGT
SQ  TGAAGCTGGCGTGAGGGGTACCAAGCATGTCCTTGAGTAAAAAGAAGGCCCCGGTGAGGA
SQ  AAAAAAAAGTTCAATCCTAGTTGGCAAAAATAATGGTTCTATGATTCAATATCTATATGT
SQ  CATGTTAATTGAAAGAACAGTGGTTCTAGGATCATGTGCTATATCCTGTTTGTTTGAATT
SQ  TATAATGATGCTGAAAAATATTGTTGCGCTGATAAGTTCGAGTGAACAGATATTAACTTT
SQ  TGTTGCGTGGGTGAAGGCCATGCCATGGCCTAAAGATCAAAGAGACGCCATCACGGTGCT
SQ  GCACTTTTCGGCTCCCTCCTGCTTCCACATGCCGCGCGTCGTCTAGA
SC  EMBL #AF124045; nt 8096-10362, release 60
XX
SF  contains MITE elements [1]
XX
TP  considered as permanent [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AF124045; AF124045
XX
RN  [1]
RX  MEDLINE; 20129767 PubMed; 10662861
RA  Tikhonov, A. P., Bennetzen, J. L., Avramova, Z. V.
RT  Structural domains and matrix attachment regions along
RT  colinear chromosomal segments of maize and sorghum
RL  Plant Cell 12:249-264 (2000)
//