S/MARt DB - S/MAR

AC  SM0000366
XX
DT  10.12.2001 12:49:00 (created); ili
DT  7.3.2002 15:08:00 (updated); ili
XX
NA  MAIZE$adh-3MAR1
XX
SY  334B7-MAR4, 
XX
OS  maize, Zea mays
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  2498 bp
XX
LO  1
DE  G001247; alcohol dehydrogenase 1, 1F allele
DP  Direction: 3'; 3455 - 5952; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G001340; open reading frame
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001247;
alcohol dehydrogenase 1, 1F allele
G001340;
open reading frame

XX
SQ  CTGCAGGCGCGAGTAAATTAATCGCATCTTTGAAGTTAGGCTCCCGCCGACCTGGCTCAT
SQ  ATAGCTGGGCTACCGGGAGAAGCCGACCTGGCTCATACAGCTGGGCTACCGGGAGAAGCC
SQ  AACCAAACATGCGCATGTATCTCTCTCGACGGATGACACAAGATCGAAGAAGCAAATAAT
SQ  TAACTACACCTCGCTCCTATATCCGAAGTGAAACTAAAAGGAGAAGGAAAAGAAGGTAAC
SQ  AGAATAGGAACCGTAAGAAGCAAATAATTAACTACACCTCGCTCCTATATCCGAAGTGAA
SQ  ACTAAAAGGAGAAGGAAAAGAAGGTAACAGAATAGGAACCGTTTGGTGAGAATTGGAGAG
SQ  GATTCGTGAGTGAGAAAATCCATTTCCATTAAATTTTAAATAGCAAGTGATTTACTCTCA
SQ  TGATCTCCTCCAGTTTCCATTTCATCAAAACAACCCTTATTCATTTTCCCCCAACACCTT
SQ  TGCTCTCAAACAAATCCCTAAGAGCTGAGGAAGAGGATTAAAAAGGATAAAATTTTCTCT
SQ  GTGTTCAATTTTAAATAGGATAGAGATTCTAACTCCCTCAGACCTTTTCGATTACACTTG
SQ  AACCGGAGAGGATTGAGGGCTCATTCGGTTAGTCTGGATTGAAAGTAGAAATCATTCTAG
SQ  CTATCAAGATAATTCAAATTTGTGAACCATTCTAATCCTAAACTATTCCAGGCGCCAAAG
SQ  GAACCGAACGGGGCTTGAGATTAAATCTCTTTCTAATTAATTTTGGCTAGAAAAGGATTT
SQ  AATCACTTTTAATCTATCCCTAACCGAATAAGCTCTCAATCATCTCTAATTACCTGGCTA
SQ  GTTTCGAACCTTCTCATGGCAATCACAATACAACTCAGACGATGCATAATATTATGGTGT
SQ  TTTCCCTTTAGAATTAATTACTGTATATGTTATATGGCAATAGGTGCAGGCATTATGCAC
SQ  GATTTTCTAACCTTAGATATTGTGTCCAAACTACGGCTATTCCTAGTCTATTATATCTTA
SQ  TCATACTATCTAAAGCTATCATGTTATATAAAATTATATAAGATGCAACTATCTTAATAA
SQ  TGATATTAGTATATTCCCAATCTAACGTGTCGTATACATTTAATACATATCATATAAGCA
SQ  TTTTTGATGACGTGGCAAAATTGTTAAGAGAAAAAAGAAAATTGTATATTAATAGAGATA
SQ  TTACTTGGCACGAGATCATATGTATTAAACTTCTAACCATCCAAGTGATCCACATCTCAT
SQ  ACTCTCACATATGCTAGTTTTTAATATTTTGTAGAGGATCAAAAAGTAATCTATAATACC
SQ  ATGCATTGAGATAGTTATATCTTATATAATTTTATATGTCATATCACCTTTGGATATTGT
SQ  GACAAGATATAATAGAGTGAAAATAGTCTTATAGATTGTTTTTTTATCTGTATAGAGTAT
SQ  TAAATACTAGCATATATGAGCGAGATGTAGGCCACTTAAACGATGTAGGTTTCAATATCT
SQ  AAGATCGTCCAAGCAATATCTCCCTCAAGGTAAACTTTCTCCCCTATAACTCTATTGCCA
SQ  CATCATTAAAAATGCTTGTGTCATATATTAAATGAGTATGTTACTATGAATTGAGAATAA
SQ  CCTAATGTATCTTCAGGATGATACAGTTTTTATCTCTCTTTTCTTTAGTCCGCCACATCA
SQ  GTGAGAAGTCCTAAGTGACATCTAATGAGTAATGTTACTACCCATTGGGGCTAGCCTCAG
SQ  CGGTGATGGTTTGCTTTCCCAATGTTATTGTGTTTGGTATTCATTTTAATACATGTCACA
SQ  TAAGCATATTTGTTGCAAAGGTTCAAAAAGATGCATGCACAACATGAAACTGTAGTTGAA
SQ  AAAAAGGATGATACAACAGACGATGAGAAATAAAAAAAATTCAGGACGCACAAGGGAAAA
SQ  TCACAATCCCAACAAATCATCTCCACAAAGTCAAGATATCTATCTCCGCTTTCCAAATGC
SQ  TGAATCTATTAGATTTGGTGCCCTTCAGATCTTGTCCATATAGTATCCAATCTGCCAATA
SQ  AGGTGGAAGTACAGTTTTACTTCAAAAAAAAAGGTGGAAGTACAGTAAGACATTCTTGAA
SQ  ATACCAATATCATTTAAAATAAGTTTATCATGAGAAGTACAGTTAAAGAATGCTTACTTA
SQ  GTTTCTTATATATGCAGCGGCCTCAGAAAACTGTATTTACCTATCTTTCATTCAGAAACT
SQ  TCACGGTGCCCATCTGATTAAATTCAGACCAGAGGTCTCCAGACACAGGATTAAAAGAAG
SQ  TGCACAATAACTTGATGGCCGCTTGACAAGTGTTGAGCTCTAAAAAGAGCGGTGCGGACG
SQ  GTCCGGCCCCGAGGCCGGACGGTCCGCGGTCCGGACAGTCCGCGGTGGTGGCGCGGACGG
SQ  TCCGCGCGTGCGCAGAGTCAGTTAGGGTTCCTAGTTTCTCGCGGGATTTGTTACCTAAAA
SQ  CCGCAGGATTAACTCGGAAATCAGTTTGAAGCGGATCC
SC  EMBL #AF123535; nt 21397-23894
XX
BP  weak, but persistent [1]; 30-40% [2]
TP  considered as permanent [2]
XX
EV  in vitro selection of S/MAR [2]
XX
DR  EMBL: AF123535; AF123535
XX
RN  [1]
RX  MEDLINE; 96038641 PubMed; 7580257
RA  Avramova, Z., SanMiguel, P., Georgieva, E., Bennetzen, J. L.
RT  Matrix attachment regions and transcribed sequences within
RT  a long chromosomal continuum containing maize Adh1
RL  Plant Cell 7:1667-1680 (1995)
RN  [2]
RX  MEDLINE; 20129767 PubMed; 10662861
RA  Tikhonov, A. P., Bennetzen, J. L., Avramova, Z. V.
RT  Structural domains and matrix attachment regions along
RT  colinear chromosomal segments of maize and sorghum
RL  Plant Cell 12:249-264 (2000)
//