S/MARt DB - S/MAR

AC  SM0000390
XX
DT  11.12.2001 15:26:00 (created); ili
DT  12.12.2001 13:27:00 (updated); ili
XX
NA  RAPE$na30-MAR
XX
OS  rape, Brassica napus
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  304 bp
XX
SQ  TTAATGATCAACTGGCGATCAAAAGGCAGACAACCCATAAAATACTTAGTATATGTATTT
SQ  TGACGTGAAGATTTATAGAATTCAATATCTTTTTCTGTTGGCTATTCCATCTACACTAAA
SQ  TCCAAGTGCGTCACATATCCATTACAATTCAACTTAGGCTCTAATTTGCAAGAATTCAAA
SQ  AGCTCTTCTTTCAAAACTAATTGAAAAGAATGAAGCTACTCTTATATTTTATTTAACTAC
SQ  ATTAGGCATCAAAATATTTCCATGTTTTATATAAAAAAATTCTTCCACGTTTTCCAGGAA
SQ  TAAA
SC  EMBL #AF223670; edited according [1]
XX
FT  193 - 208: found duplicated after S1 retroposon integration
FT               [1]
XX
FF  retroposon integration site [2]
XX
EV  in vitro selection of S/MAR [2]
XX
DR  EMBL: AF223670; AF223670
XX
RN  [1]
RX  MEDLINE; 98440763 PubMed; 9767691
RA  Tatout, C., Lavie, L., Deragon, J. M.
RT  Similar target site selection occurs in integration of
RT  plant and mammalian retroposons
RL  J. Mol. Evol. 47:463-470 (1998)
RN  [2]
RX  MEDLINE; 21312510 PubMed; 11419796
RA  Tikhonov, A. P., Lavie, L., Tatout, C., Bennetzen, J. L.,
RA  Avramova, Z., Deragon, J. M.
RT  Target sites for SINE integration in Brassica genomes
RT  display nuclear matrix binding activity
RL  Chromosome Res. 9:325-337 (2001)
//