S/MARt DB - S/MAR

AC  SM0000394
XX
DT  25.1.2002 15:27:00 (created); ili
DT  25.1.2002 16:46:00 (updated); ili
XX
NA  MOUSE$C-5MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  3697 bp
XX
LO  7
DE  G002968; tyrosinase
DP  Direction: 5'; 15000 - ; Pos 1: transcriptional start
DN  Internal: n; 
XX
SQ  GAATTCTGTCCTAAAACAGTCTTTGGGCTTTCTTTGGGGGGCCGGGGGGGATTTGGAGTC
SQ  TTTTAATGATTGCTTTTATTTTCTTATATATTACAGGTCTATTTAAATTGTTAATATGAT
SQ  TTTCATTTAACTTTGGTAAGTGATACCTATCAAGAAAATTGTCATTTCCAATTTTATGAA
SQ  GTACAGGTTTTTGACATATGTGCTAGTAACTTTCTGTGTTTCCTTGGTGTCTGCTGTTAT
SQ  GTTCCCTTTTGGTTTCAGGTTTTATTGATTGGGATAGTCTCTCAGTGTCTTTTAGTTATT
SQ  TTTGAATAAGAGTTTTTCTACCTTGTTGATGTTCTCAAATAACCTACTCTTTGTTTCATT
SQ  GTTAATGTGCATTCTTTTGTTTCTATTTTATTGGTTCCAGGCATGAGTTTGATTATTTCC
SQ  TACTTTTTACTCCTCTTGGGTGTGTTTGTTTCTTTTTGTCCTAGGGATTTTAGCTGTGCT
SQ  ATTAAGTTGTTAGTATGAGATGTCTTTAATTTCTTTACAAAGACACTTAGTGCTAAGCAC
SQ  TTTTCTCGTAACACCACTTTAACTGTGTTTGGGTATATCTTGCATTCCTTTTCATTGAAA
SQ  TCTGGAGAGTCTTTTATTTCTTTCTTTATTTCTGCCTTGACCTCAAAGTCATCCAGTAGG
SQ  GAGTTGTGCAGCTTTCATGAGTTTGTAGGTTTTCTGTTGTTGAATCCCACCTTTACTCCA
SQ  TGTTGTCTAATAAGACACAAGGCATTATTTCAACTTTCTTATATCTGTTGAGGCTTATTT
SQ  TGTGAACAACTATATGATCAATTTTGGAGAAAGTTTAAGGATTGCTGAGAGAAAGGTGCC
SQ  TTCTTTTTTTGTTTGGGTGAAATGTTCTAAAAAATATATATTAGGTCTTTTACCTCCATT
SQ  ATTTCTTAGTTTAGTTTTTGTCTAGATGACATGTCTATTCATGAGAGTAGGATATTGAAG
SQ  TCTCCCACTATTAATGTATTAGATTCAATTTGTGATTTGAGCATTAGTAATGTTTCACTT
SQ  CCAAATGTGTTACCCTTGCTTTGGGGACATAGATGTTAAGAACTGAAGTGTTATCATGGC
SQ  TAATTTTTCCTTTGATGAGTATGAAATGTCATTTTCCATCTCTATTGACTAATTTTCTTG
SQ  TAAAGTGTGATTTGCTAGATATTAGAATAGCTAAAACAGCTTGCTTCTTGAGTGCATCTG
SQ  CTTGGAATATTTTTTTTCAACCCTTAACTGGAGGTATTGTCTATCTTGATGTTGAGGTCT
SQ  ATTTTTTGTACTCAGTGAAATGATTGATTCTCTTTTTGCATCCACTCTGTTTGCCTGTGT
SQ  GTTTTATTGAGTAATTGAGTCCATTTACTTTGAGAAATATTAATGATCAATGATTCTTCA
SQ  TTTCTGTTATTTTGGTGGTGGTGGTGATAGTAGTGATAGTTGTGTGCATGTGTATGTGTG
SQ  TGTGTGTATGTGGGTGTGTTTGATTTTTCTCTGTATCATGATTGCCTATATGCAAAACTG
SQ  TAAATATTTTTCATTAATACACTAGAATTTGTGTTTAAATGATATACAGACTAATCTATA
SQ  CCAAATGTGTTATTACAGATTTTCTAGACTAAATGACTCATCAATCCTCTGTTAGATTTA
SQ  AATTTTGGGTAACTCTTTTATATATGTATCCTTTATAATGGATTTAGAAGTTTGAATCCC
SQ  ATCAAAAAGACAGTACATATATATTGTATGGAAGAATATCAAAGTTTTGTAGTGATAAAA
SQ  CTAGGCAATTTTGGCCTAGAGCTTTGCAGTGATGATTAGTAGCAAGAGTTTGGTTGTAGT
SQ  AATATGTTATCACACTGTCTCTCTGAAATGATATTTCTCTAAATATTCACTTCTAGCAAT
SQ  CATGTTCATTTGTTTACATGAACCACCAAACCTAAACATGAACTACAAAATGTATGAACT
SQ  TTCACCCACAGTGTTATTTTCTCATGGCTCTTGTCCTTTGTTCCAAATTCAACCAGTTGA
SQ  AATAATGGCAGTATTTTGTAAATTCTGTACATTTTTTTTCTCTGTTCCCTATACTTGACA
SQ  AAAATTTCCCTTTTTTCACATTCCTCTATTTACACTGTTCTTTTTTCATGGTTAAGAAGA
SQ  GTCAGTATGACCCTTCAAGCAGTGTTTCCTAACAATCTTGTCTCTTAGGCTCATTTATAG
SQ  AGGGAATGAGCTATGTCTCCACAATACCTCAATATTACTTGAGAATAAATTCCAACATAT
SQ  AGACCTGGTAATAAGCCATAAGTACCTTGTTCCATTGATAAGTGTTCACTTGGACCCATC
SQ  AGTTACTATTCCATACATCTTCACTTTCTGAACCTCATTTATGTTTGAAAATTCAAGATT
SQ  AGAATAACTATTTAATGGAGGTTATTTACAAAGATGCATTATGTGGCATTTGTGGTAAGA
SQ  ATCATTTCGTGGGTCCACAAATCCATTGCATCATTCCTTGAAGTGGTTTAAGTCTTTTGA
SQ  TTGTCATTGTTAATAACTGCATTAAAAGATTCCTTCATTCCCTGATTTGAGCTTGACTTT
SQ  ACTCACAGCTAGAAAATTAGAGGCAGAAGGAGAGTGAAGTCAAAGGTCTGCAACTTCCTC
SQ  TTTGCCACATAACAAGAAAGTTGCTTATATCCTTCTCCAAGGTCATAGTTCCTGCCAGCT
SQ  GACTTTGTCAAGACAGTGATGTCTGTGTTCCAGCAGTTGTTCTGAGTATCCTTTTCATTA
SQ  TCCACTGTCCTTTCTTCTTAAATTCCACCCCCAACATTGTAAATAGCTTCTTTCTTAAAC
SQ  TCTGTTCAAAGAACCAGCTTGAGTGTGTCAGCTGCTTCCTGCTGGGGTCCTGGCAAACCA
SQ  CAATATTATTAACAATATGTACCCAATAAAGAGTCCTGAAATTGCCACACCATCACCTTT
SQ  TAATATTCCTATTCAGATTGTGAACTTCTACAAAGCAGGAATGTGGCTTGTTTATTTTCC
SQ  TGTTATCTTGCACTGTCACACTTAATTCTTGGGAAAATAAAAACACAAAATATGCATTTC
SQ  TTTGGTCTACTGAATGAAGATGGAATGTGTATTACTCTGACTCTTTAAATGTAAATGGTG
SQ  CTTCATATTCCTCTAAAGCCTTAAGCACAATAACACAGGGTGGGTGGTAAGAAAATATCT
SQ  GTAGTATGGATACAAATTTGTTCCATAAGAATATAAGTATAAAATTATTAAATAAAATGT
SQ  TTCAGGAAAATTTAAACTGGAACAAATCAAGGTAAGTATCATCTAAAAATGAGCTTAGGT
SQ  AGACATGTTGAGTTGAGCTTCTAGGGAAGCTGTTAAGAGTAATTATTTAGAAAAAAAGTA
SQ  GGTCAAGAAGAAAACACTAAATAGATTATTCAGATAAACATTTTATTTCAAATAGTATTT
SQ  TCATAGAACATTTTGAGGGCATCTGTTTGGAAAGAAATTGATTATTGCATTAGCTCTGAG
SQ  ATTCACATCTTTCTTGTTTATATAAGAGCTCTTTTAAAATTGTGTTTTATGATACTGTCT
SQ  CTTGTTGAATGTTGCAGTCTCTCCTCCAATTCAGACATCTCCAAGGGTCAGGAAGCAACA
SQ  TGAGCAATTCAGTGAAAGATAGTATATTTCCAATGTCTAACCAAAAATTGTAGATTCTGA
SQ  TGAAAGCCTGGTTGTGTGATGAGACACACAGAGAGAGAATCAGACTTGGAAAATGGCTGC
SQ  ACAGCTACAAATACTTCAAATACTTGCTATCAAGCTT
SC  EMBL #X76647; nt 1-3697, release 69
XX
FF  capable of dampening position effects in a cell
FF  type-specific manner [3]; necessary for expression
FF  [3] [2]; contains melanocyte-specific DNase I
FF  hypersensitive site which has enhancer activity [3];
FF  regarded as locus control region, LCR [3]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: X76647; MMTYRE
XX
RN  [1]
RX  MEDLINE; 92346911 PubMed; 1822431
RA  Porter, S., Larue, L., Mintz, B.
RT  Mosaicism of tyrosinase-locus transcription and chromatin
RT  structure in dark vs. light melanocyte clones of homozygous
RT  chinchilla-mottled mice
RL  Dev. Genet. 12:393-402 (1991)
RN  [2]
RX  MEDLINE; 95009539 PubMed; 7925014
RA  Porter, S. D., Meyer, C. J.
RT  A distal tyrosinase upstream element stimulates gene
RT  expression in neural-crest-derived melanocytes of
RT  transgenic mice: position-independent and mosaic expression
RL  Development 120:2103-2111 (1994)
RN  [3]
RX  MEDLINE; 99331082 PubMed; 10402671
RA  Porter, S. D., Hu, J., Gilks, C. B.
RT  Distal upstream tyrosinase S/MAR-containing sequence has
RT  regulatory properties specific to subsets of melanocytes
RL  Dev. Genet. 25:40-48 (1999)
//