S/MARt DB - S/MAR

AC  SM0000403
XX
DT  6.2.2002 13:48:00 (created); ili
DT  7.2.2002 11:33:00 (updated); ili
XX
NA  MOUSE$A11COL-5MARIIBD
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  3223 bp
XX
DE  G000469; alpha1(I) collagen
DP  Direction: 5'; 3435 - 219; Pos 1: transcriptional start
DN  Internal: n; 
DC  5' flanking sequence [1]
XX
SQ  AGATCTGCCTGCCTCTGGCTCTTGAGTGCTTAGAATTGAAGGTGTAAACCACTGCTACCT
SQ  GACAGAGGATTTCTTACACATGTCTGACTGGAGCGCTAAGAGGCATCAAACTCAGCATAA
SQ  GCAGACCTGAACTTGTTGGCTTTCCCTTTAAATCAGCCAGGAAAGGAGGGATGGGGAGAG
SQ  GAAGGAAATGCTCAGAAGGAAAGGAGTAGTACTGAAGGTGAGCTGGAGGAACCCAGATCG
SQ  GGCCATACAGAAGAAAAAGGAGAAGCAACGCACCCACACACCTAGGCTCCACCCACAGAT
SQ  GTTGCTCTGGGTACCTCTGTCTGAAGACTGTAGGGCTTTGTGATGGAGGGTGGGGTATGC
SQ  TTCATGCCCATGGCCTTTACTCCAGACCTAAATGCCCACCCCCACATACAGCTGCTCTTT
SQ  TTCCCTGCCCTTCTCCCGAGAGACCAGCTCTCCATCCCTGGTCTGCAGCCAAGGCTGGGG
SQ  GCAGAAGAACTTTCTGGAGGATCTGAGTGAGAAAAGCAAGAGAGCCTCGAATAGGGACTA
SQ  GAACCACTGGGGCGCAAGTGCAGAGGAGACCGGGTGTGTGCCCTACCTGCTACATTTATA
SQ  CCTAGGCTGCCTCTGCTTCTGTTCCACACCGTAGAGTCCAGACGGGTCTTCTCCCTCCCT
SQ  CGTGGGGGGGGAAACATTTGGGAAAATTTGGAGAGAGACAGAACTCAGAGCTCAGCACTT
SQ  TCCTCTTTCTGTTTTTCTTCTTGAGGAATTTTTTTCCCCCAACGGCTGATGACTTTACCA
SQ  TTCTTGGGGGTGGGGGGGGGTGGAGATTCTGGCTTTTGCTCTCCCTACACTCCAAGTGCC
SQ  TGACAAAGCCCTACATTCCTCAAAAAGCCAGAGCTTTAGAGTTTCCTAAAGATGAGGTGG
SQ  CGTGGCGTGGCGTGGCGTTCTCCTCCCTTCCCAGCTCCAACTCCCCCTCCCCCAGTCTCC
SQ  AGCCCTCAGCCCAGCCAGGGAGGCCCCGCCAGGCTGGGAGGAGACCCCAAGCACATTCTT
SQ  CCTCTCTCTGTCATGCTGCAGAAATTAAAGACACATCTCTGAGCTGGGCACCCGCCAATC
SQ  GTTTCAAGTAGAGAGTGGCAGAGGAGGTCCTGAGCTGCAGCTCCATGCCACGTGTAAAGG
SQ  AAGCTTGGAACCCATTGCCTTCAACTCCTGGGGCAAAGGCCTGGAAATCAGACACAGGGT
SQ  GACGGCTGTCACTGAATGCACACACACCAATCTCCCCCACACCCATTCTAGTGGTCTCCA
SQ  AGTTTCCATCAGAACCTCAGGCCCTTAATGTAGCAATCACCAGTTCATACCTGTTAGGCT
SQ  CTTGTCTCTTCTTCCAGGTGAGCCTTGGGGATGCTAGATTGGGAGCAGGGAAAGGGAGCT
SQ  TTGGATAAGTGCTTTTCTGATACAAAACCCAACAAAGGGTGAGCAGATCACACCGCGCGC
SQ  GCGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGCACGCTTCGTGGCAT
SQ  TCTACCCTGGACACAGCCACCTCAAACACCTGTTCCCTCTGGAGGTACACCATCCTTGTC
SQ  CACTGTTGGGGAGTGGGGCATCCTTTGGAACTGACCACAGTGGAAGGCAGGACTTTGGTG
SQ  AGTTCCGGAACTACCATCTCAGCATCTCAGCCCCAGCCTTGCCCTACAGGCACTGGCATT
SQ  AGGCGGGGGCAGATCCTGGGCCACAAGTTACTGCCACATGGTTGGGATAATTGATGAAGT
SQ  CCTGTCCTTCCATTGCTGTCTCCAGCTCTGCTTCTCTGGAAACTCTATATTTTCCCTTTA
SQ  ATTATAGCCCCTGCAGTCTCCCTCCGCCACCCCACCCGCACTGCTCGGCCTAGCTGCCCA
SQ  CGCGCAGCGACGTGCTCCCTCCCCTTCTGTTCCCTTGGTCTTTTTTTTTTTTCCCTTTGC
SQ  CTTCGTTGCACAAAACTAGCTCAGGGAGGGCGTGAAGGGGGGGGGGGGAGCAATGGAATC
SQ  TTGGATGGTTTGGAGGAGGCGGGACTCCCTGCTTCCACGTTTACAGCTCTAAAGAAGCCG
SQ  GTGGGGGAAGTGATACAGGATGTCTATGGGCCCTGCAAGGAGACCCCAGTGCCTTCCCAC
SQ  ACCACCCACACAGTTTGACAAGATGAAGTTCCTAAGCAGATTGGACAGAGCACCTTTGCA
SQ  GGGTGCAGGGAGCACCGGGGAAGAACGGACACTGTCTTTTAGCGACAACTTTAAATATAA
SQ  GCTGCTGTTCTTGGGGGACTACAGATGACCCTTTCCTGACGGCAGAGGTGGGGAGCAATG
SQ  GCCAAGATTTTCAGCAAAGAAGTGAGGACATGGGAAGAAACCATTAAATAAAGTCCCTCA
SQ  GCTACCAAACACAAGTTTCTGCCACACACTGAGTTCACCTAGGTGTCCCCAGACCACATC
SQ  CAAGTACAATTAGAAAAGAGGGCTCTCTGTAGCTTTGAGAACACCCCTCTATGGCCAAGT
SQ  ACCTTCTACCTGTTCATTCTGCATTGATATTGCTACATAAGAGGGCCTCTAACAAATCTC
SQ  TGGCTGTGGCCACAGCTGACACAAGACCTTTTTCTAAAACATCCCTGGTCACAGGCTTCC
SQ  TGCAACAAACTCACATCCCAGTGCTGGGATGGAGGAGGTCAGAGAAGAATTTATACAACA
SQ  TGCCCCAGGCCCCAGCTTTGAGGACCCAGAAAGCCCCCTGCCCACACTGCTGCTCATCAC
SQ  TTAATGCATAAGCATTCTTCTGGAAGGACAAGGATGTCAAAGGTCTCCCCAAGCCTCAGC
SQ  CTCAGAGCTGTTATTTATTAGAAAGGTGTGTCTGGCATGGCAGAACAGATAGGCACCCCC
SQ  TTCCTTTCAAACCACCACATATCTGACTCTTAGTATCTGTGAAGAGATGTATAACTGTTC
SQ  ACAAATATTCCTACCCTCCATTCCTGGGTCCACACCATGAGGTGATCCCCTCCCTCCAAC
SQ  AGGCACATCTGCTTAGCTGATAGGTTCTAATCAGATTAATCTAACTTATTCCTTAGTTCT
SQ  TCCCCAGGATGCCTGAAAGATTACTAGCATGGCCAGGAGGACCTTTTCCCAATTATTCCT
SQ  GACACTGATCCCTTTGTAGTGTTTCCCAACTCAGATTCTCAGTTCTACATCCTTCTGATT
SQ  TGAAGTCCCAGAAAGAAAGTACAAGGGGTATTCTCTACCCACACTCAGTATACTGAGGGC
SQ  CCAGCCACACTCCAGTGACAGCACCTCTGGCCCATGTAGATCT
SC   [C. Mielke, direct submission]; EMBL #U38307 and #X54876
XX
FT  328 - 463: strong binding to matrices prepared from Os
FT               cells [1]
FT  499 - 634: strong binding to matrices prepared from Os
FT               cells [1]
FT  635 - 805: strong binding to matrices prepared from Os and
FT               3T3 cells [1]
FT  1664 - 1811: strong binding to matrices prepared from Os
FT                 and 3T3 cells [1]
FT  1691 - 1967: strong binding to matrices prepared from 3T3
FT                 and Os cells [1]
FT  2239 - 2427: strong binding to matrices prepared from 3T3
FT                 and Os cells [1]
FT  2845 - 3045: strong binding to matrices prepared from F9,
FT                 3T3 and Os cells [1]
FT  3094 - 3218: strong binding to matrices prepared from Os
FT                 cells [1]
XX
SF  contains unwinding elements [1]
XX
BP  caution: matrix binding was detected only when relatively small DNA fragments invoking central unwinding elements (UEs) were used, binding potential of individual subfragments ranges from 0 to about 100% [1]
TP  facultative [1]
XX
EV  in vitro selection of S/MAR [1]
EC  subfragments display different affinities to nuclear matrix
EC  preparations from Balb/c 3T3 fibroblasts, Os50K8
EC  osteoblasts and F9 embryonal carcinoma cells [1];
EC  matrix binding was detected only with relatively small DNA
EC  fragments [1]
EP  diverse subfragments of different size [1]
XX
DR  EMBL: X54876; MMCOL1A11
DR  EMBL: U38307; MM38307
XX
RN  [1]
RX  MEDLINE; 21671410 PubMed; 11813254
RA  Mielke, C., Christensen, M. O., Westergaard, O., Bode, J.,
RA  Benham, C. J., Breindl, M.
RT  Multiple collagen I gene regulatory elements have sites of
RT  stress?induced DNA duplex destabilization and nuclear
RT  scaffold/matrix association potential
RL  J. Cell. Biochem. 84:484-496 (2002)
//