S/MARt DB - S/MAR

AC  SM0000405
XX
DT  6.2.2002 14:14:00 (created); ili
DT  6.2.2002 15:51:00 (updated); ili
XX
NA  MOUSE$A11COL-MARIICE
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  2585 bp
XX
DE  G000469; alpha1(I) collagen
DC  locate to the proximal promoter and exons and introns 1-5
DC  [1]
XX
SQ  AGATCTGGGGGGCAAGGGCGGCAGAGTTGCGGGAGGGGGGGCGCTGGGTGGACTCCTTTC
SQ  CCTTCCTTTCCCTCCTCCCCCCTCTTCGTTCCAAATTGGGGGCCGGGCCAGGCAGTTCTG
SQ  ATTGGCTGGGGGCCGGGCTGCTGGCTCCCCCTCTCCGAGAGGCAGGGTTCCTCCCAGCTC
SQ  TCCATCAAGATGGTATAAAAGGGGCCCAGCCAGTCGTCGGAGCAGACGGGAGTTTCTCCT
SQ  CGGGACGGAGCAGGAGGCACGCGGAGTGAGGCCACGCATGAGCCGAAGCTAACCCCCCAC
SQ  CCCAGCCGCAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCG
SQ  GCTCCTGCTCCTCTTAGGGGCCACTGCCCTCCTGACGCATGGCCAAGAAGACAGTAAGTT
SQ  CCAAACTCTGGGGAGTTTACTACAGCTTCTTGGTATTGCGTTCTGTATAGAGGGGTCCTA
SQ  GCAGATAAGACTTAAATGGAGGTGCAGGGCTGCTCCAGAGGCAGGGATGGGACGGTGATG
SQ  GAGAGGAAACGGGATGAGAGAGGTCACCCTGCTGAGCAGTGAGGGGAGCAGTTCTCAGAA
SQ  GTGGAGCCTTGCATGAGATGGCCCAGGAAGAAATTTCAAGCACCCATCTGTAGCACAACA
SQ  GGAAAAGTGGGAATCTGGACACGGGTTGGGGCAGAGTACGTCGAAAATGAAATAAGGCCT
SQ  CTGGAATAGAGATTCGGAGCTCAAGATGTAAAAGCTATCAAAAAGGCTGCGGGATGATTC
SQ  ATAAGGAAAGATTGTTTGCCCTCTCTGCAGGCTAGACAGTGTTGCTGGGGCCTCCGGGGT
SQ  GCTGGGCTCTCGGGGGGGGGGGAGGGGACGCACGGAGAGGGCGGGTTGCTGGATGAGAAA
SQ  GTTTGGCTAGGACTTGACTGGGCGCGGTCCCTGTGCCTCCTGCTGGCCAGCCGAGAGCAC
SQ  TACGAGTCCTGGTACAGCACTTTACAGCGCACAGGCTGAGAAGGAAAACCTGGGTTATTG
SQ  CGGACCCTCATCTCCAGACTAGGAAAATAAAAGCAGGGATGGATGGGGTAGCTCTGGTCT
SQ  TTGAAAGAAGTGACCCAGGCCGAGTAAAAGTCGGTCCGCCCCTGCATTGCTTAGTTTTGC
SQ  CCGCCACCTAGTGGTTGCCTTGATCAGGTCCTGGAGCGGTGGGCGTGGTTAACTCATCAT
SQ  TACTATTTGTAGACTTGACTTCTTTGGCTAAGGAGATTCCAAAGCACTACTGGCTTTGAA
SQ  GGACCCGGCTTGTCTAGTTAGCAAGTTTTCAAGATTCCTGGGAGCTGGAAATTGGGATGT
SQ  ATCTAACTTTAGGGATACATTTTACTACACTGGACAGGGCTCCACTGAAATCAGCCCCTC
SQ  CACATTGTAGCCCCGCCCATTCCGCCCCACCTGCCCCGGGAAAGGAGGTGGGACCAGGGC
SQ  TGAATTTCCCCTTCTCTCCTCCCACCCCCGCCTCCTGTCTCCGCGCAAACCACGTCCCAC
SQ  GAGCCCCCACCTACTGCGTAGGAGCCCTCCTACTCTCCTTCAGCAGGCTTTTTTATTTCA
SQ  TTTGGTTCCCGCGCGGCTGGGCTGAAGTTGTTTGGAAGAAACCCCAGTCTAGAGCTTTGT
SQ  TTAAATTCCTGAGAACTGGGACGTTATAGTCCTGGCCAGGCGCCCTGGTGCTGTCACTGA
SQ  ACGTCGCCGATATGGAGCAGACCTGCATTTAAGGATTTGAGGGAAGAATATAGGGAGTGG
SQ  GGGGAAAGATTCAGGAAGTGGGAAGTCTCCGTGCGCCTCTTAGACAGGGCAAAGAGTGAG
SQ  TAAGGCTGGGATCCCTGGTGCTCCGGGGTAAGGTCTCTGACCCGCACACATCCTGTGTCT
SQ  CTTCCCATTTGCTCAGTCCCTGAAGTCAGCTGCATACACAATGGCCTAAGGGTCCCCAAT
SQ  GGTGAGACGTGGAAACCCGAGGTATGCTTGATCTGTATCTGCCACAATGGCACGGCTGTG
SQ  TGCGATGACGTGCAATGCAATGAAGAACTGGACTGTCCCAACCCCCAAAGACGGGAGGGC
SQ  GAGTGCTGTGCTTTCTGCCCGGAAGAATACGGTACGGTTCTGGTCCTAGGGTTAAGGGAG
SQ  GTTGGAGTCCCTCCCTCGCCTATGTCTTGAAAGCCTATAACACCCCCAGGTACCTTAGTA
SQ  AATTTACTTCTAACTGAACGTTTTTCTCCCCAGTATCACCAAACTCAGAAGATGTAGGAG
SQ  TCGAGGTAATAATCTGCTCCCTACTTTGCTCCCACCCGTGCACGACCCCCACTGTCCTCC
SQ  AATAAACTGCAGTTTTCTTTGCTTCTCTTAACGGCCTTTTGTTTCTTCATCCTCAACCCC
SQ  ACAGGGACCCAAGGGAGACCCTGGCCCCCAAGGCCCAAGGGTAAGCATGGTATTCTAAAT
SQ  GAGCTGGGAAACTGGAGGGGGCGTGGCTCTGATTTGTGCTCATAGCAGCCCCCTCCGTCT
SQ  CTTGGGTGCAGGGACCCGTTGGCCCCCCTGGACGAGATGGCATCCCTGGACAGCCTGGAC
SQ  TTCCTGGTCCTCCTGGTCCCCCTGGGCCCCCCGGACCCCCTGGCCTTGGAGGAGTAAGTA
SQ  GATCT
SC  EMBL #X54876; nt 1408-3992
XX
FT  221 - 413: exon 1
FT  332 - 805: strong binding to matrices prepared from F9 and
FT               3T3 cells [1]
FT  440 - 588: strong binding to matrices prepared from Os
FT               cells [1]
FT  1190 - 1608: strong binding to matrices prepared from F9
FT                 and 3T3 cells [1]
FT  1877 - 2071: exon 2
FT  2194 - 2225: exon 3
FT  2287 - 2580: strong binding to matrices prepared from F9
FT                 and 3T3 cells [1]
FT  2345 - 2380: exon 4
FT  2471 - 2573: exon 5
XX
SF  contains unwinding elements [1]
XX
BP  caution: matrix binding was detected only when relatively small DNA fragments invoking central unwinding elements (UEs) were used, binding potential of individual subfragments ranges from 0 to about 100% [1]
TP  facultative [1]
XX
EV  in vitro selection of S/MAR [1]
EC  subfragments display different affinities to nuclear matrix
EC  preparations from Balb/c 3T3 fibroblasts, Os50K8
EC  osteoblasts and F9 embryonal carcinoma cells [1];
EC  matrix binding was detected only when relatively small DNA
EC  fragments
EP  diverse subfragments of different size [1]
XX
DR  EMBL: X54876; MMCOL1A11
XX
RN  [1]
RX  MEDLINE; 21671410 PubMed; 11813254
RA  Mielke, C., Christensen, M. O., Westergaard, O., Bode, J.,
RA  Benham, C. J., Breindl, M.
RT  Multiple collagen I gene regulatory elements have sites of
RT  stress?induced DNA duplex destabilization and nuclear
RT  scaffold/matrix association potential
RL  J. Cell. Biochem. 84:484-496 (2002)
//