S/MARt DB - S/MAR

AC  SM0000409
XX
DT  13.2.2002 11:22:00 (created); ili
DT  13.2.2002 16:44:00 (updated); ili
XX
NA  HS$TCRdeltaE-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1265 bp
XX
DE  G000395; T-cell receptor delta
DP  Direction: 3'; Pos 1: delta enhancer
XX
SQ  TCTAGAACTAAAGCCAAAAACATAAGGAACCAGATTCTTAGGAATAAGTTTCCTGCCCTG
SQ  AGTGACTGAAACAGAATCAGTCTTTTAGTTGAGCTTCTCAGCAGAGGAAACGGGGAGAAT
SQ  GATGATGGTAGTGATGGGGGGTTTCTCTGAATAGTTGATTTTCTAGGAAAACCATGATCA
SQ  ACTTTGGTCCATTTACAAAGCCGTGATCAGCAGAAACTTCCTGACTAGCAATCGCCCCCT
SQ  CTCAACCAGATATAACCAGTTGATCTGGCAGTAGCTCTGCTGCTGTGAACCTCACAGCTG
SQ  AAGCCCAAATTCAGATTCAGGATAAAGCATTAGAAAAATTATTTATTTTTATACAGAAAA
SQ  TTAGCCAGGTGTGGTGGTGTGCACCTGTGGTCCCAGCTACTCGGAAGACTGAGGCTGGAG
SQ  GAGAGTCTGAGCCAGGAGGCAGAGGTTGCAATGAGTTGATATTGGGCCACTTCACTCCAA
SQ  CCTGGGTGGAAAAGACCCTGTCTCAAAAAAAAAAAAAAAAAAGGAAAAGGAAAATTACTT
SQ  ATTTTCCATTTACACATTCATTACCAACTTTCTGTTCAGCAACACCTAATGTCTTGATTA
SQ  TAGACCATAGTAGGTAAAAGTACACTGGAATTCAATGTATTTTTCATTTGATATCAAGAA
SQ  GCAAAATTCACCTAAGTTTCAAATACTAAGGGCCAAATTTACAGGAGCAATTAATATTAA
SQ  AAGTCAGCATTAAATTTAGGATTGAAAAATGTATCTTGATCATCATTCACAGGTTGGTTG
SQ  TGTTTCTTGGTTTCAGGTATTAACAGGGCTCTTTCTTTAACAGTTATTTGAAGATAGCCT
SQ  AAGAATTTAAGTCCCCATGGACACAACATTTATCACAATTCAAAAACTTCAGTGAGGCAC
SQ  TGTGTGAAAGAATCATCACTACCTCTCTCAAAGCTTCAAGACTTGTGGTCTTAAGGAAAG
SQ  AAAAGTATGCATGTACAGGGTGGTAGTCCAAAGTGAGGCACAAAAGAAGAGAAGGCCAGG
SQ  AGGGAAGCCAATCCTGGGACCAACATTCCACAGTTCCTCTTAGATTAAAACAAGAATGAA
SQ  CGGGCTTCAATTGGTTTTATTTCTTTAAGGACTTCCTGAAAATGATCATTGTTATCCTCT
SQ  GATTAAAGACTCAAAGGAAACTATACAGTAGTCAGTCCCCTACAGAAGAATGAGTATTCA
SQ  CCTAAAGGCAGAAACATGTACCACCTACCTTCAGCAGATCCCTTTCCACCCTTTCCAGCA
SQ  GATCT
SC  EMBL #AE000661; nt 214769-216033
XX
FT  707 - 721: Drosophila topoisomerase II consensus site
FT               (13/15) [1]
XX
SF  stretches with A/T/C sequence context [1]
XX
FF  adjacent to enhancer [1]; weaker than SM0000408
FF  [1]; suggested to have major influence on the delta
FF  enhancer-dependent V(D)J recombination in single copy
FF  transgenes, but to have little or no influence on these
FF  event in multicopy integrants [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
EC  tested fragment contains both MARs surrounding the TCR
EC  delta enhancer and the enhancer itself [1]
EP  3.8 kb Bam HI-Bgl II fragment
XX
DR  EMBL: M94081; HSTCRADCV
DR  EMBL: AE000661; AE000661
XX
RN  [1]
RX  MEDLINE; 99449792 PubMed; 10518560
RA  Zhong, X.-P., Carabana, J., Krangel, M. S.
RT  Flanking nuclear matrix attachment regions synergize with
RT  the T cell receptor delta enhancer to promote V(D)J
RT  recombination
RL  Proc. Natl. Acad. Sci. USA 96:11970-11975 (1999)
//