S/MARt DB - S/MAR

AC  SM0000412
XX
DT  14.2.2002 16:23:00 (created); ili
DT  14.2.2002 18:14:00 (updated); ili
XX
NA  MOUSE$P17-MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1225 bp
XX
LO  Y
XX
SQ  AAGCTTTTAAAATAATTAAAATACTTTATATTTATCTATCTACCTATCTACCTTCTACCT
SQ  ATCATCTACCTACCTACCTACTTAACTACCTACCTACCTACCTATCTTATCTATGTATCT
SQ  TATCTATCTATATCTATCTATCTATCTGTCTATCTGTCTATCTATCTATCTATCTATCTA
SQ  TCTATCTATCTATCTATCTACCTATCTACCTACCTACCTATCTATCTATCTATATACTTT
SQ  TTACGGTTTTTCAAGACAGTGTTTCTCTGTGTAATTCTGCCTGTCCTGGAAATCACTTTT
SQ  TAGACAAGGCTGGCCTTGAAATCAGAAATCTGCCTGCCTCTGCCTGCCATATGCTGGGAT
SQ  TAAAGCCATTGGACATCACAGAAAGGAGACCTGAAAATACTTAAACAAACAAACAAAACA
SQ  AAAAATAAAACAAAAATACAAAACAAAACAAAACAAAACAAACAAACAAAAAAAAAAACA
SQ  GGACCTCTAAATGACCATTAAAAATTCTAAAAACACTTTAAAAATGCCTAAAATTCCCCA
SQ  AAATCTCAAAACCCTAAAAAGACCTTAAAAATTGTAAAAGCAAAAAAACAAAAAACAAAA
SQ  AAAAACAAAAAAACAAAAACAGAAGAACAAACAACACACACACACACACACACATGCTTA
SQ  AGTGTGAACCTGAGAACCTAATATTTTAAGAGACTTCTAAAGAAAAATCTAAAATTCTAA
SQ  AGAGAACTCAAGAAGTCTTACTAAAAAAACAAATGAAACAAAGAAACAAAATATAAAACA
SQ  AACTAATGAAAAAAAAAACCTAAAACTCTAAAATAACTTAAAAAAAATAGAACCCCAAAA
SQ  AAGACACTAAAAACCGCAATGCCCAAAAACCCTGTGTACTGTGGCTTGAGAATAGGCACA
SQ  CACAAATATATTAAATAAACAAATGAATTTGAATAAATAAATACAAATATTTTGACTTTA
SQ  GGCCATGTTTCTGCTATAAGCATTAACGTTGGCAAAATCAGAGCTGGCAAGAAGGCTCAG
SQ  CAAGTCAAATTTCTTTTTTTGCTCCCTGGCAACTGGATTTCAAGGACTGAATCCATATGG
SQ  GAGAAAGGGAGAATTTCACTGAGTTATTCTTATACACAATAAACAAGCAAAAATAATCAA
SQ  TCTGTAATAATTAAGGCCAAATGTTGGCTATTGCATTAACTGTGGTGGAATTAGAACTGG
SQ  TTATGTTATAAATGTTGCTGAATTC
SC  EMBL #X71670; nt 1459-2683
XX
FT  28 - 33: ATATTT- motif [1]
FT  33 - 230: TATC tetranucleotide repeated 22 times [1]
FT  635 - 654: CA dinucleotide repeat [1]
FT  681 - 686: ATATTT- motif [1]
FT  914 - 923: A-box (10/10) [1]
FT  932 - 941: A-box (10/10) [1]
FT  947 - 962: ATATTT- motif [1]
FT  1156 - 1168: potential hairpin loop structure [1]
XX
FF  part of a repeat that has been suggested to be specific for
FF  the Y chromosome of mice and assumed to be present in
FF  200-300 copies [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: X71670; MMP17SAR
XX
RN  [1]
RX  MEDLINE; 94310056 PubMed; 8036156
RA  Singh, L., Panicker, S. G., Nagaraj, R., Majumdra, K. C.
RT  Banded krait minor-satellite (Bkm)-associated Y
RT  chromosome-specific repetitive DNA in mouse
RL  Nucleic Acids Res. 22:2289-2295 (1994)
//