S/MARt DB - S/MAR

AC  SM0000415
XX
DT  22.2.2002 17:41:00 (created); ili
DT  22.2.2002 17:41:00 (updated); ili
XX
NA  HS$D19S208_3
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  400 bp
XX
LO  19q13.12
DE  G003006; myelin associated glycoprotein
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
DC  in the 8th intron of MAG [L. Nikolaev, direct submission]
XX
SQ  GTACAGAATAGCTGGAGAGATGACACAGATGCACATAAAAAGCTACTGTCTTGGAAATGA
SQ  AACTCACCATTGCACCGCTGGCCAGCGCCTCTCATCTCCTCACTATGGACTGTGCCACCA
SQ  TCTCCCACCACCCCTACCCCCACAGCCATCACTCCAGGTTGTAGCAGCCAAGTCACAGTT
SQ  TTGACTCCCCTTCCTTAAGCAATTCCCTCTGGAATATCGCCTTCCTGTTTCCATTTCCCC
SQ  TGCTTCCTCCCAAGTTCCTGTTGGCTTCTAGCACTCCTCCCCAAATTTCACCTCTCTGGT
SQ  CTTCACGATGCCCACAATGGCCCCCACCACACAAGTTTGCCAGAAGGTTCGATGACATTC
SQ  AACATGCAAAGAATTCAAAGCAGTGTCTGCTACACAGTAC
SC  [L. Nikolaev, direct submission]
XX
BP  75% [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AC002132; HSAC2132
XX
RN  [1]
RX  MEDLINE; 21671420 PubMed; 11813264
RA  Chernov, I. P., Akopov, S. B., Nikolaev, L. G., Sverdlov,
RA  E. D.
RT  Identification and mapping of nuclear matrix-attachment
RT  regions in a one megabase locus of human chromosome
RT  19q13.12: long-range correlation of S/MARs and gene
RT  positions
RL  J. Cell. Biochem. 84:590-600 (2002)
//