S/MARt DB - S/MAR

AC  SM0000416
XX
DT  22.2.2002 17:44:00 (created); ili
DT  22.2.2002 17:46:00 (updated); ili
XX
NA  HS$D19S208_4
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  978 bp
XX
LO  19q13.12
DE  G002991; 
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -5
DE  G002993; upstream transcription factor 2
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -4
DE  G002996; liver-expressed antimicrobial peptide
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -3
DE  G003000; CD22 antigen
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DC  about 100 kb downstream of CD22 antigen gene [L. Nikolaev,
DC  direct submission]
DE  G003006; myelin associated glycoprotein
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DC  note: two intronic MARs  have also
DC  been assigned to the MAG gene [1]

G002991;
G002993;
upstream transcription factor 2
G002996;
liver-expressed antimicrobial peptide
G003006;
myelin associated glycoprotein
G003000;
CD22 antigen

XX
SQ  GATCATTCCAATATCTTGCTTCAAATCCTCGAATGACTTCTAGAGGCTCTTAGAATACAA
SQ  ATTCCTTTCTGTGACCTGGAAGCCCCTGCTCAGCTCCTCAACCTCATCTTCTTTCACTCT
SQ  GTCCCCATTGATAGTATTCCAGCCCAGAGGTTCTCAATATGTGGCCTCTGAGCCAGCAGC
SQ  TGCTGCATCACCTGGGAACAAGCCACTTGACACATCGGCCTGTTTCTTCATTTGGAAGTT
SQ  GAATCTCCTAAGTTAGTGATGTTCAGCTGAGCCCTGAACAATGAAAGGGAGTTGACATAC
SQ  AAAGGCCCGCAGGAACATTCTGGAAACAGAAATTGCTGATGCAAAGGCTCTGAGGAGAGA
SQ  GAAAACCTTAGCATCTCTCAAGGCCAGAGAGAAGGCCAGTGAAGGGCTCAAACAGGGGTT
SQ  TTAAATGTAAGCAAATATTGGAACTACCTGAAGCGTTTGCTGAACCATAGATGACTGTCC
SQ  TCACTTCCCCAGGACTTCAGAATCAGTAGGGATATTGGTCAGGGTTCTCCAGAAAACAGA
SQ  ACCGAGAGGACAGACAGATTACATAGACAGATAAGTAGATAGGTAGACAGATAATAGATT
SQ  AGAGAGATAGAGAAAGAGAGAGAGAGACAGAGACAGAGAGATAAAGATACACAGGTAGGT
SQ  AGTAGGTAGACAGATAATAGATTAGATAGATAGATAGATAGACAGATAGAGATAGATAGA
SQ  TATACACAGGTAGCTAGTAGGTAGACAGATAATAGATTAGATAGATAGATATGCACAGGT
SQ  AGGTAGTAGGTAGACAGATAACAGAGTAGATAGATGATAGATAGACAGATAGATAGATGA
SQ  TAGATAGATAGATAGATATACACAGGTAGGTAGTAGGTAGACAGATAATAGATTAGATAG
SQ  ATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGATAGATAGATGGGGGAA
SQ  GGGTAGGAAGCCCTGATC
SC  [L. Nikolaev, direct submission]
XX
BP  20% [1]
TP  suggested a structural role [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AC002997; AC002997
XX
RN  [1]
RX  MEDLINE; 21671420 PubMed; 11813264
RA  Chernov, I. P., Akopov, S. B., Nikolaev, L. G., Sverdlov,
RA  E. D.
RT  Identification and mapping of nuclear matrix-attachment
RT  regions in a one megabase locus of human chromosome
RT  19q13.12: long-range correlation of S/MARs and gene
RT  positions
RL  J. Cell. Biochem. 84:590-600 (2002)
//