S/MARt DB - S/MAR

AC  SM0000421
XX
DT  25.2.2002 13:28:00 (created); ili
DT  25.2.2002 13:45:00 (updated); ili
XX
NA  HS$D19S208_9
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  181 bp
XX
LO  19q13.12
DE  G000961; peroxisomal acyl-CoA oxidase
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DC  note: an intronic MAR SM0000419 has also been assigned to
DC  the POX 1 gene [1]
DE  G001340; open reading frame
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: -9
DC  note: a total of 3r putative genes can be assigned [1]
DE  G003003; cytochrome C oxidase subunit VIb
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -8
DE  G003004; uroplakin 1A
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -7
DE  G003011; testis zinc finger protein
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -6
DE  G003012; trithorax homologue 2
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -5
DE  G003014; nephrosis 1, nephrin
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DC  about 2 kb upstream of NPHS1 [L. Nikolaev, direct
DC  submission]; note: an intronic MAR SM0000420 has also
DC  been assigned to the NPHS 1 gene [1]
DE  G003015; amyloid beta (A4) precursor-like protein 1
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  note: an intronic MAR SM0000422 has also been assigned to
DC  the APLP 1 gene [1]
DE  G003016; DNAX-activation protein 10
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 2
DE  G003017; TYRO protein tyrosine kinase binding protein
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 3

G001340;
open reading frame
G003003;
cytochrome C oxidase subunit VIb
G003004;
uroplakin 1A
G003011;
testis zinc finger protein
G003012;
trithorax homologue 2
(-2 --5 ) (-2 --5 )
G000961;
peroxisomal acyl-CoA oxidase
G003014;
nephrosis 1, nephrin
G003015;
amyloid beta (A4) precursor-like protein 1
G003016;
DNAX-activation protein 10
G003017;
TYRO protein tyrosine kinase binding protein

XX
SQ  GATCAGGCCATCAGCGTCTCAGCCAGCAAAGGCCTGAACCACCAGTCCCTTATAACCCTG
SQ  TAAGTCCAACCCCCACTCCCAACCCCACTCCCCCATTTAGGGACACGGAGTCTGAGCCTA
SQ  AGAACAGTGGAGAATCTGAATGTGGACCCTCCAGTTCTTACAGGTCCAGGAATGTCAGAT
SQ  C
SC  [L. Nikolaev, direct submission]
XX
BP  70% [1]
TP  suggested a structural role [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AC002133; HSAC2133
XX
RN  [1]
RX  MEDLINE; 21671420 PubMed; 11813264
RA  Chernov, I. P., Akopov, S. B., Nikolaev, L. G., Sverdlov,
RA  E. D.
RT  Identification and mapping of nuclear matrix-attachment
RT  regions in a one megabase locus of human chromosome
RT  19q13.12: long-range correlation of S/MARs and gene
RT  positions
RL  J. Cell. Biochem. 84:590-600 (2002)
//