S/MARt DB - S/MAR

AC  SM0000427
XX
DT  25.2.2002 13:34:00 (created); ili
DT  25.2.2002 14:17:00 (updated); ili
XX
NA  HS$D19S208_15
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  368 bp
XX
LO  19q13.12
DE  G001340; open reading frame
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  note: a total of two putative genes can be assigned [1]
DE  G003018; RNA polymerase II/I
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 2
DC  about 10 kb dowstream of POLR2I gene [L. Nikolaev, direct
DC  submission]
DE  G003019; cytoskeleton-associated protein 1
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 3

G001340;
open reading frame
(2 -0)
G003018;
RNA polymerase II/I
G003019;
cytoskeleton-associated protein 1

XX
SQ  GATCGCGCCACTGCACTCCAGCCTGGGCAACAGAGCGAGACTCCGTCTCAAAAAAAGAAA
SQ  AAAAAAGAGAACCCCAAGAGTTCTCCAAACCCAGTTACTGCCCCACCCTGCATTGCATTA
SQ  GGCTCTCCATTGTCCCCACACTTTTCCTGCCATCCTTTGGTAGTATTAAGCTTTTTCACC
SQ  TCGGTCAGTCTCGTGAGTCAAATATCGCATCCCACGGTTTAAGTTTGCATTTCCCTAACC
SQ  CCCGGTGCTGTTGAGCCTTCTGACTTCTGGGTTGTGGTGTTGCCTCTTTGGGGACTGCCC
SQ  GGTTATGTATGTGGCCTGTTTGTTGGGTTGTTTGTCCTCTTTTCATGGATTCTGTGTCTT
SQ  TCCAGATC
SC  [L. Nikolaev, direct submission]
XX
BP  40% [1]
TP  suggested a structural role [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AC004144; AC004144
XX
RN  [1]
RX  MEDLINE; 21671420 PubMed; 11813264
RA  Chernov, I. P., Akopov, S. B., Nikolaev, L. G., Sverdlov,
RA  E. D.
RT  Identification and mapping of nuclear matrix-attachment
RT  regions in a one megabase locus of human chromosome
RT  19q13.12: long-range correlation of S/MARs and gene
RT  positions
RL  J. Cell. Biochem. 84:590-600 (2002)
//