S/MARt DB - S/MAR

AC  SM0000428
XX
DT  25.2.2002 13:35:00 (created); ili
DT  25.9.2002 14:05:00 (updated); ili
XX
NA  HS$D19S208_16
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  505 bp
XX
LO  19q13.12
DE  G001340; open reading frame
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: -3
DE  G003018; RNA polymerase II/I
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DE  G003019; cytoskeleton-associated protein 1
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DE  G003020; calcium-dependent protease, small subunit
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  about 3 kb upstream of CAPN4 gene [L. Nikolaev, direct
DC  submission]
DE  G003021; cytochrome C oxidase subunit VIIa polypeptide 1
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 2

G001340;
open reading frame
G003018;
RNA polymerase II/I
G003019;
cytoskeleton-associated protein 1
G003020;
calcium-dependent protease, small subunit
G003021;
cytochrome C oxidase subunit VIIa polypeptide 1

XX
SQ  GTACACAGATGAGCCTAGCAGAAGATTCAGAGACTTGACTAGTTTGGCCATGCAAGAATT
SQ  TCTTTTTTGTTTTGTTTTTTTCTGTTTGTTTTGTTCGGCTCACTGCAACCTCCACCTCCT
SQ  GGGTTCAAGCGATTCTCTTCCCTCAGCCTGTGGAGTAGCTGGAATTACAGGTGCCTGCCA
SQ  CCACACCCGGTTTGTGTGTGGGTGTGTGTATTTTTAGTAGAGATGGGGTTTTGCCATGTT
SQ  GGCCAGGCTGGTCTCGAACTCCTGACCTCAAGAGATCCACCCACCTCAGCCTCCCAAAGT
SQ  GCTGGGATTACAGGTGTTGAGCCACCTCGCCCGGCCCAAGCAAATAATTTTTATCAGGGA
SQ  ATTGACTCCAAAGAAAAACAATAGGAGAGGAGGTCCTGCAGGGTCACAGCCCATACAAGA
SQ  GTCTGGCCGCAAGGAAGCCTGGTAAGAGGAGAGGGAACAGAGCGGTGCTGACCTGCTGAA
SQ  GGGAAGGCAGAGGTCGGACAGGTAC
SC  [L. Nikolaev, direct submission]
XX
FT  1 - 63: LTR/ERV1 [L. Nikolaev, direct submission]
FT  95 - 336: Alu [L. Nikolaev, direct submission]
XX
BP  50% [1]
TP  suggested a structural role [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AD001527; HSAD1527
XX
RN  [1]
RX  MEDLINE; 21671420 PubMed; 11813264
RA  Chernov, I. P., Akopov, S. B., Nikolaev, L. G., Sverdlov,
RA  E. D.
RT  Identification and mapping of nuclear matrix-attachment
RT  regions in a one megabase locus of human chromosome
RT  19q13.12: long-range correlation of S/MARs and gene
RT  positions
RL  J. Cell. Biochem. 84:590-600 (2002)
//