S/MARt DB - S/MAR

AC  SM0000429
XX
DT  1.3.2002 14:31:00 (created); ili
DT  6.9.2002 16:38:00 (updated); ili
XX
NA  MOUSE$lambda-MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1768 bp
XX
DE  G000541; immunoglobulin lambda light chain
DC  located between C lambda 3 and J lambda 1 [1]
XX
SQ  CTGCAGCTGTAGGACCCAGAGTGGGGTCTCTTCTCTATACTAGCTATCTTAACCCTTATC
SQ  TCTTGCCCACTGAATATTAAATAAAATATCATTAGTTAATCAAAAGTACTGCTTTGTTCC
SQ  ATTTGTTCTCATATATTTAATTTTCAACCTTTGAATCTACAATGTGGGGAGGGAGAATCA
SQ  TGGTTCTCAATGAGAAATTAATTTACATCTGAAACATACTGAGGGTACCACCCCAACAGT
SQ  GACCTTTGCCCTGTTCTGTGCTGTTCTCTGAGACTTGTCATGCAGGTACACCCGTTAAGA
SQ  ATGCTTGTCAAGTGAGATATTGTGTTTCTGAGTTAAACAACTAACTTGATGTTATATAGA
SQ  AAGTTCCTGCTGGGCAGAGGTGTTGAGTGCCTTTAATCCCTGCACTTGGAGGCAGAGGCA
SQ  GGTGGATTTCTGAGTTCAAAGCCAGTCTGGTCTATAGAGTGAGTAAGTACCAGGACAGTG
SQ  AAGGCTACACAGAGAAACCCAATGTTCTTGCAATAAACTTAGAGAATGTTGTTATATGCT
SQ  TCAGAACATTGGTGCTCCTGATCATCTATACTGAGACATGTGATAGGATAAACACTCAAG
SQ  CATAATAATTATGTCTAGTGAGAAATACACCCAACTTGAGACCAGAAAGGAAATCAAATA
SQ  ATTGTGTATAGGAAGTAGTTTCACAGTCAAAAACAAGACTACTCAAGGTCATGTCAGGTG
SQ  GGGTCAAGGATGACTGAGTGGGACCTGTGAGCTAAATTCAAGCCATTTGCTTGGGTAAAC
SQ  TTAGGTGTAATATACCCCCATTTTAATGACCCATGTCCTCTGATGTGTAGCACCCCAGTG
SQ  TGCATTTTAGAATGATGCCAAACAGTCTTTGAAATTGACATTCAATTTTCTGTGGTCCTG
SQ  CNTCTATCCAGGTCAGTATGTAATTAGTGTTCATTGTTTGGGACATCATCYTCTCTAACT
SQ  CATAAGTAACATGGACATTGAGTACATTCATAATTCTTTGGTAGATCATACAGTCCCATA
SQ  CAGCATAGTCTTCCAAAGTATTCTTCAACAATGAGGGAGAATAGCAGTTGACAACATAGA
SQ  CCATGATCTTAGACATCTAAATTCCCAGTTTCTGAGCTAGGAAGAACTTTTGGGATCTGT
SQ  GCCCTGCAGATCTGTCCCTAATAGTTGGAAGTGAAAATCACAGCAATGTTCCTTCTGGAG
SQ  ACAGCCAAAACTCATCCATACCCATTTTTTTTTCAGAGACTCATAGTCTTGTTTCAAGTT
SQ  TTCAGTCAAAATTTCCCTGACAAGTTTGAACAGAAAAATTAAGAAACAATGAAAAAGTAA
SQ  TGTTCCCATATCTATGCAACACCAACACACATTTTACCTGGATTTTGATTCACAACTATA
SQ  ACTATTTAATTAAACTATAACTATTTAATTATAACTATCCTGTAACTATAACTTTAACAA
SQ  AAATGTCATCCCTATATCATGTTAAGAAAGCTGATCCCAGAATTTATATCTTGTTAGCTA
SQ  AAATTATACTTCTGCATTTTTTAAAGAATGCCTAGGTATTATAGTAAACATCAAAAGAAG
SQ  TTATTGATCACTTCTATTTCTTCATAAAACAGTCAGCAAACATGTCATGATCCTTCAGTG
SQ  TTTAGTATAATATTATTGGCAATGATTCTACCTTGTGTAGGAAGATGAGATGTGGATAGA
SQ  TACTGATGACTGTGTATGTGTTCTCCAACTGCTCTCTCCTGAAGTGCCTCAGATGTTTCT
SQ  CTCTGATTTTTTCCAGCATGAGCTGCAG
SC  [H. Engel, direct submission]
XX
BP  stronger than SM0000001 [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: X58411; MMIGCL012
XX
RN  [1]
RX  MEDLINE; 21451046 PubMed; 11566322
RA  Engel, H., Ruehl, H., Benham, C. J., Bode, J., Weiss, S.
RT  Germ-line transcripts of the immunoglobulin lambda J-C
RT  clusters in the mouse: characterization of the initiation
RT  sites and regulatory elements
RL  Mol. Immunol. 38:289-302 (2001)
//