S/MARt DB - S/MAR

AC  SM0000430
XX
DT  7.3.2002 11:49:00 (created); ili
DT  7.3.2002 15:02:00 (updated); ili
XX
NA  WHEAT$Bx7-5MAR
XX
OS  wheat, Triticum aestivum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  781 bp
XX
DE  G003048; high-molecular-weight glutenin Bx7
DP  Direction: 5'; 1560 - 750; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G003048;
high-molecular-weight glutenin Bx7

XX
SQ  GATATCGACTTGATATTATGGATATTTATGTATTTCTCTACAAATTTGATCAAACTTTAA
SQ  AAGGTTTAACTTCTCAAAAAAAAAACTAATACACCTTATATTTTAAAACAGAGAGAGTAG
SQ  TTTTTTTTTACCCAAACCCCAACTGCCCAGCAAAGCGCGCTCAACTCTTCTAGTCTAAAT
SQ  AACTAGCATCCACTAACACATTTCTCCCGACATGCAAGCACGTCACCTATGAAAATGCCC
SQ  ACCTCAATATGCAACCATGCATAGAAGAAAGCTCACCTCAGCATGCAAACATGCAGCATA
SQ  ATTTCCATTTTACTTGGCTATTTATGTTTGATAAATATTTCACAAATATACAATAATCAA
SQ  AAACAATAAATTATATGTGTTTTTAGTTTTAGTTCTCATATCCAAATATACATGTTTCAT
SQ  ACAACCAAATCTCATTTAAATATATTGTAAAATATTCCGGCAACAACTTGTGGGGTACAT
SQ  CTAGTTACAGTGGAATATTAGTGATGGCGTGAGCAAGCGATAAGGCCAACGAGAGAAGAA
SQ  GTGCGTCGTCTATGGAGGCCAGGGAAAGACAATGGACATGCAAAGAGGTAGGGGCAGGGA
SQ  AGAAACACTTGGAGATCATAGAAGAACATAAGAGGTTAAACATAGGAGGGCATAATGGAC
SQ  AATTAAATCTACATTAATTGAACTCATTTGGGAAGTAAACAAAATCCATATTCTGGTGTA
SQ  AATCAAACTATTTGACGCGGATTTACTAAGATCCTATGTTAATTTTAGACATGACTGGCC
SQ  A
SC  EMBL #X13927; nt 14452-15292
XX
SF  T-box, core unwinding element and Drosophila topoisomerase
SF  II consensus site [1]
XX
BP  approx. the same strength as Adh1 (5' ???) MAR from maize [1]
XX
FF  leads to a slight increase in transformation efficiency in
FF  leaves [1]; minimal effects in transient assay [1]
XX
EV  re-binding assay (high salt) [1]
XX
DR  EMBL: X13927; TAGLB11B
XX
RN  [1]
RX  MEDLINE; 20358518 PubMed; 10902712
RA  Rampitsch, C., Jordan, M. C., Cloutier, S.
RT  A matrix attachment region is located upstream from the
RT  high-molecular-weight glutenin gene Bx7 in wheat  (Triticum
RT  aestivum L.)
RL  Genome 43:483-486 (2000)
//