S/MARt DB - S/MAR

AC  SM0000455
XX
DT  8.12.2003 16:09:00 (created); ili2
DT  8.12.2003 16:09:00 (updated); ili2
XX
NA  HJEC$trs1
XX
OS  Hypocrea jecorina (Trichoderma reesei)
OC  Eukaryota; Fungi; Ascomycota; Pezizomycotina;
OC  Sordariomycetes; Hypocreomycetidae; Hypocreales;
OC  Hypocreaceae; Hypocrea
XX
SZ  2873 bp
XX
SQ  GAATTCTCTTTTATTTACATCGTATACACTTTCTTCTAAGAATCTAGTAAATGAACCACC
SQ  GAATGATACACGATTAAATAGATAAACTGAATAAGCTGCAGAGAATACTATAGAAGTACA
SQ  GGCGAATACTCCTAATACAGGTAATCTTTCAACAATACTGTATAATGACATAAACTCTCC
SQ  TATGAAATTTAAAGTCAATGGTGTACCACAATTACCTAAAGTTAAAATAAAGAACAGTAT
SQ  TCCTAATATAGGCATTAATTGTGCCATACCTCTGTAGAAATAGATAGATCTAGTTCCAGT
SQ  TCTATCATATAAAACTCCTCCAGCGCAAATAAATAGACCACTAGAAACGAATCCATGTGC
SQ  TAATCCTAATACTACAGAACCTTCCAGACCCTGAAGAGTATTACTGAATATTCCTATTAA
SQ  ATAAACAGCAGCATGACATACAGAACTATAGGCTATTAATTCTTTTATATCAGTTGTTCT
SQ  TATTGTACTAAAACTAGCATATATTATTGTTATAACAGCTATAGTATAAACTACAAAAGT
SQ  ATAATCTAAACAAGCTTTAGGTAACATAGGTAAAATTAATCTAAATATACCATATAAACT
SQ  TAATTTTAATACAATCCCAGCTAAAACTATACTTCCACCTAAAGGTGATTCAACGTGAGC
SQ  TTTTAATAATCAACCGTTTAAAAATATTGTAGGTGTTTTTACAGCAAAAGCTATAAATAT
SQ  ACCTATAAATAAGAATATTTGAGTTTTATATTCAAAGTTAAGTTTAAACAATGTATCAAA
SQ  GTCTGTACTTCCCATAGTAGATGAAGTACTTAAAATAGATAATAATAAGAATAAAGATCC
SQ  TCATAATGTATATAAAAATAAATAATAACTAGCATTTACTTTGTTATCTGAACCAAATAT
SQ  ACCTATTAATATAAATAAAGGAGGTAATATACTTTCGAAGAATATATAGAATACCATTAT
SQ  ATCTAATGCTAAGAATACAGCTAATAACAATGTTTCTAGTAATAACATTATTATTAAATA
SQ  AGATTTAACATTTTCCTTTATAGAATCCCAGTTAGATAATAATGCTATAGGCATTATTAT
SQ  TGTTGTTAATAATACAAAATATATTGATATACCATCTACTCCTAAATAAATATCAAAAGA
SQ  TTGTACATTATAATGCTCTTGTACAAATTGAAATTGATTAGTACTACTATTAAATAATAT
SQ  AAATATAACTAAAGATATAATTAAATTTATTATACTAGTAACTAATGCTATAGTTTTTGT
SQ  ATAAATAACTGAACTTTTTTTATATGAGTCTATACTAGAAACTATAATTGTACCAATTAC
SQ  AGGCACAGTTAATAATGAAGATAATAACATCTTGTATAAGATATTATTTTAAAACTTTAA
SQ  ATTATAAAATGACACCTATGGACATGCGTTTCATGGCTATAATAGATAAAAAGAGCGTAT
SQ  TTTTTAAAGGCTAGAGAGTGAATTACCCTCTTACTAAAGAAAATATAAGCACTCCATATT
SQ  GTTTATAATAAATACATATTTAGAATAAACTTATATTTATAAAGAAGATTCCAAACATGT
SQ  ATAATAAAGATGGAATTAATATTATAAATGCAAATAAAATAGGTAATAATACAGTTCAAC
SQ  AGAATGACATTAATTGATCAAAACGTATTCTAGGAAAAGACGCTCTAACTCATATAAAAA
SQ  TAAATACCATTATTGAACTTTTTATACCTAAAGTTATACTAGATAATAATCCATCTACAG
SQ  AAGAGCTAGTTAATAATTCTCTTAATGCAAAATATTCTGATGATACAATTCATTCTATAT
SQ  TAAACACATTAGCATAAATAGAATTTAATAAATCAAATCAATAAATATAGTCAAATTGTA
SQ  ATAAATAACCACCTAAGAACAAAATACTTGTTAAAATACACATTAATAAAATACTTGCAT
SQ  ATTCAGCTAAGAAAAAGAATACAAATATAACCGCTGCGTGTTCTGTCATAAATCCACTAA
SQ  CTAATTCAGATTCAGCTTCGGCTAAATCGAATGGAGCTCTATTAGTTTCTGCTACAGAAC
SQ  CTATAAAAAATATTATTAGAATACAAAATAATGGTAAAGCTAATCATACTATTTTTTGGA
SQ  ATTGAACATTTATATTTAAGTTTAAACTATTTGTTATCATTACAATAATTAATAATACAG
SQ  AACTTAAAACTAATTCATAACTAATTAATTGAGCTGTACTTCTTAAAGATCCTAAGAAAG
SQ  CATATTTACTATTAGCACTTCATCCAGCTAATAATATCCCATAAGTGGCTAAAGATGATA
SQ  CTGCTAACATAAATAATATACCTAATTCCATATCACCTATAGATAATCCTGGTCCATATG
SQ  GAATAACAGCATAACCTAATAAGGCAAATATTAATGTTATAACTGGCCCTAAAAAAAATA
SQ  AAATTATATTAGCTTGTGTAGGTGCTACATATTCTTTTAATATTAATTTTAAAGCATCTG
SQ  CAAATGCTTGAAGAAGCCCATAATAACCTACAGCATTTGGACCTAGTCTTCTTTGCATAC
SQ  TAGCCATAGTTTTTCTTTCTGCTACAGTTATGTAAGCTACTGCTAATAACGCAGGTAGTA
SQ  GTAATAATAAATTTTCAATAAGTGAAATAACTGTTATTGGTAATTTCATTTCATTATTAA
SQ  TTTTACTTATTCTATTAACAATGTTCCCATTTTAATCATAGAAAGTTAATAATACTTTGA
SQ  TGGCTCCTACCTAGCTGGTGCAAGGATGGCTGCATAAAACAAAGATTAATGTTTATAAAA
SQ  AGCGTTTAATCTTAGGTCCTCTAGGACTATAAATTGATTAACTTTGTCTAGTATATGTGA
SQ  AGTATATTTAGGATTTTGTTCCTTACTTCTTATTTCTAATCTTTTATGAATTC
SC  EMBL #Y14562
XX
FF  promotes autonomous replication in Saccharomyces cerevisiae
FF  [1]; does not promote efficient replication of plasmids
FF  in T. reesi [1]; enhances T. reesei transformation
FF  frequency [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: Y14562; TRTRS1
XX
RN  [1]
RX  MEDLINE; 98000882 PubMed; 9341675
RA  Belshaw, N. J., Hakola, S., Nevalainen, H., Penttila, M.,
RA  Suominen, P., Archer, D. B.
RT  Trichoderma reesei sequences that bind to the nuclear
RT  matrix enhance transformation frequency
RL  Mol. Gen. Genet. 256:18-27 (1997)
//