S/MARt DB - S/MAR

AC  SM0000456
XX
DT  8.12.2003 16:15:00 (created); ili2
DT  8.12.2003 16:15:00 (updated); ili2
XX
NA  HJEC$trs2
XX
OS  Hypocrea jecorina (Trichoderma reesei)
OC  Eukaryota; Fungi; Ascomycota; Pezizomycotina;
OC  Sordariomycetes; Hypocreomycetidae; Hypocreales;
OC  Hypocreaceae; Hypocrea
XX
SZ  847 bp
XX
SQ  GAATTCTTAAGTAAAATAATAGCTACTAAGTAATAAATTTATAAAGGTATTATAATAAAA
SQ  AAATATAAAAATAGTAAAAAGTATTATAATTAAAGACTAATTAAGTAAAAAATAAGTATA
SQ  TATATATTTAAAAATAGGCTATATAGTAATAAGTTTTTATAATATATAAAAATTATTAAA
SQ  TAAGCCTAGGTTTTAATTAAATATAAAAAAATAAAAGTAAATACTAAAAAAATAAATAAA
SQ  AGGTAAAATAATTATATTAAGATAATATAATAAAAGAAAGGTTACTTATTAAGATTATAA
SQ  TATATAGCCTTTATAAAAAGGCATAGCTTTTAAAAAGAGTTTAATATAAAGTTAAATTAA
SQ  ATATATATAAGATTATAATAACCTTAATATAAAGTGCTTATAATTTTATAATATTATTAT
SQ  AGCTATAAAAAAAGTAAACTATTTTTTTATTTTAAGAAGGTTTAAAAATAAATATAGTTA
SQ  CTTATAAATACTTACTTTTAAAAGTAATTATATAATTAACTCTTAAACTACTTAGTAGTA
SQ  ATTAATAACTATATATTAACTTTTTATAACTTTAATTATCCTCTCTTTCTTTTTACTTCC
SQ  TTATATTATATACTAGCTTTAATAAAAAAAGCCTAGTAGTTTTATTAATAAAAATATTAA
SQ  AAAAAACTTAGTTAAAAAAAGTATAATATTTTAATTTATAAATAAAGTAAATATTATTAT
SQ  TAAATATTTAATATACTTTTTAATAATTATAAAAAAGATTATAATATTATTAATAAATAT
SQ  AGCTATAAAGCCTTTATACTTTTTTAAGATTTTATTTATAAAATATTAAATATATATTAA
SQ  GGAATTC
SC  EMBL #Y14563
XX
FF  promotes autonomous replication in Saccharomyces cerevisiae
FF  [1]; does not promote efficient replication of plasmids
FF  in T. reesi [1]; enhances T. reesei transformation
FF  frequency [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Y14563; TRTRS2
XX
RN  [1]
RX  MEDLINE; 98000882 PubMed; 9341675
RA  Belshaw, N. J., Hakola, S., Nevalainen, H., Penttila, M.,
RA  Suominen, P., Archer, D. B.
RT  Trichoderma reesei sequences that bind to the nuclear
RT  matrix enhance transformation frequency
RL  Mol. Gen. Genet. 256:18-27 (1997)
//