S/MARt DB - S/MAR

AC  SM0000488
XX
DT  17.2.2004 15:27:00 (created); ili2
DT  10.3.2004 15:56:00 (updated); ili2
XX
NA  HS$CD8B1-3MAR5
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1825 bp
XX
LO  2p11
DE  G001436; CD8 antigen, beta polypeptide 1
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
XX
SQ  CCTAAGGAGAAGGRGATACAGATTGGCTGGTCATGGAGCAGTCAGAACACACCCAACATT
SQ  TATGATCAAGTTCACTGTCATAAATGGGCATGGTTCATGGTGCCCTAAAACAATTAAAAT
SQ  AGTAACATCAAAAATAACTGATTACAGTCACCAGAACAGACACAATAATAATGAAAAAGT
SQ  TTGAGGTATTGCAAGAATTATTAAAAGGTGATCCAGAGGCACAAAGTCAACACATGCTAT
SQ  TGAAAAACAGCATTGATAGATTTGCTCCAGGCAGGGTTGCCACAAACTTTCAATTTGCTA
SQ  AAAATACAACATCCGTGCAGCACAATAAAAAAATAAAGTGCAATAAAATGAGGTATGCCT
SQ  GTACTTTAAACAGTGCCTGGAACACAGCAGGTACTCATTACATACAGTTACTCTGTTAAT
SQ  TATGAATATATACTTTATTTATTTATTTTTATTTATTTATTTATTTTGAGATGGAGTCTC
SQ  GCTCTGTCACCCAGACTGAAGTGCAGTGGTACAGTCTCGGCTCACAGCAACCTCCATCTC
SQ  CCAGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACCACAGGTGCCCGCC
SQ  ACCACGCCCGGCTAATTTTTATATTTTTAGTAGAAACAGGGTTTCATCATGTTGGCCAGG
SQ  CTGGTCTCGAACTCCTGAACTCAGGTGATCTACCCATCTTGGCCTCCCAAAGTGCTGGGA
SQ  TTACAGGCATAAGCCACTGCACCCAGCCAGTGAATATATATTTTTAATATGTAAATTACC
SQ  TCCTCCCATGAATTATGAATTATGCCAAATATAAAGAAAACTACTGAAGGTAACATACTA
SQ  GCTTCAAGTTTATTTAGCAAATTAGCAGATTTGCTAAATAAATCTGTCAGATTTAGCAAA
SQ  TTTAACTTTTGCCAAATTTGCTTCAGTCTTTTATTTCAAGCAATAAAATGTTTGTGTTGA
SQ  GACCCCTTCTTCACCCCTATTCCATCCTCCATACTGCATACCCTATCTTGAAATTTGTGG
SQ  GTTCTGCCTCCAGGCTTTTTTTATACTTGTGATTCTCTTATTATGTAAGTATCTATAAAC
SQ  AATGACATAATAATGAATAATATATGGCATGTGCTTTTATTTTTTATAAATAATGTCAGA
SQ  GTGTACATGCACTTTTAAAATTTGCTTATTTCATTCAACATATTTTTGAGATTTACCTGT
SQ  GTTGATGCCTGTGGATCTAGTTCATTTATTGTGTCATATTTTATTAATGTATTACAATTT
SQ  TATTCATTCCCCTATTAGATATTAGTTTATAATTATTATTACAATTTTCCAATTTCTGTT
SQ  GTTTGTGCTTCTGTGAACACTCTTATACATCAAAACTTCTCTGAGCAATGAATCTGGAAG
SQ  TGGAAGTTCYGGGGCCCAGAGCATCTTCATTTTTAATAGATATTTTTACTAGATATCCCA
SQ  AATTATCTCCACTGCAGTTGTAACAATTTACATCCCCCATCAACATTGCATCACAGTWWT
SQ  TTGGTCATATCCNTCCCTCATGCTTGATGTTATTGGTCTTGTTCATTTTGCTAATTTGAA
SQ  AATAAAATGATATTGGTTGTTTTCATTTGCATCTCCACTGATTCAAGTAATGTTTGGCAT
SQ  CTTTTTATTTGGATATTGGCTTGGTCACGTACTTTGCCCATTTTTAATTCTGCTGTCTTT
SQ  AACTTATTACTTTGTGAGAGTCTGATATGTTATGGATAAAGATCTTCTGTTGCTTTTATG
SQ  CACTGCAAATATCTTCTACTAATTTGAGACTTGTCCTTTAACTTTGTATTGGTTTTTGCC
SQ  CTGCATACTTTAAACAAATGTTCGA
SC  EMBL #AY032722; nt 4837-6661
XX
FT  1163 - 1362: strong SATB1 binding [1]
XX
SF  closely linked to T cell-specific DNase hypersensitive
SF  sites in cluster III [1]; predicted to comprise a base
SF  unpairing region [1]; overlaps at its 5' end with a
SF  Tigger 1 element [1]; contains LINE/L1 and Alu elements
SF  [1]
XX
BP  42.6% [1]
CH  suggested to be part of a locus control region-like regulatory unit [1]
XX
EV  re-binding assay (high salt) [1]
XX
BF  SB000012; SATB1 [1]
MM  direct gel shift; 
SO  rec(human-); human
QA  6
BF  SB000012; SATB1 [1]
MM  assessment of the dissociation constant; 0.04-0.15 nM
PR  subfragment
SO  rec(human-); human
QA  6
XX
DR  EMBL: AY032722; AY032722
XX
RN  [1]
RX  MEDLINE; 21935500 PubMed; 11937547
RA  Kieffer, L. J., Greally, J. M., Landres, I., Nag, S.,
RA  Nakajima, Y., Kohwi-Shigematsu, T., Kavathas, P. B.
RT  Identification of a candidate regulatory region in the
RT  human CD8 gene complex by colocalization of DNase I
RT  hypersensitive sites and matrix attachment regions which
RT  bind SATB1 and GATA-3
RL  J. Immunol. 168:3915-3922 (2002)
//