S/MARt DB - S/MAR

AC  SM0000500
XX
DT  23.2.2004 15:24:00 (created); ili2
DT  23.2.2004 16:34:00 (updated); ili2
XX
NA  Y$HMLA2-3MAR
XX
OS  yeast, Saccharomyces cerevisiae
OC  Eukaryota; Fungi; Ascomycota; Hemiascomycetes;
OC  Saccharomycetales; Saccharomycetaceae; Saccharomyces.
XX
SZ  1080 bp
XX
LO  3
DE  G009226; 
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G009226;

XX
SQ  AGCTTCAAATTACCAAAGATCGTCCAGAAGCTGCTATGGACTTTATTGAAGTAACAGCTT
SQ  TCAATACATTCATGAAGTCATTAGGTACAACTCTTGGTGGTGTGCTTTCAACCACTGTTT
SQ  TTTCCGCCTCCTTTCACAACAAAGTATCACGAGCTCATCTAGAGCCTTACGAAGGAAAAA
SQ  CGGTTGATGACATGATTTTGTATCGTCTTCAAAACTACGACGGTTCTCATTCGACTATTG
SQ  GAAACATTTTAAGCGACTCCATTAAGAACGTATTTTGGATGGATCTAGGGTTTTATGCCT
SQ  TAGGATTTTTGTTTTGTAGTTTTTCATCCAATAAGAAATTAATCATACCAAAAAAGGACG
SQ  AGACACCAGAAGATAATTTAGAAGACAAGTAGCGCAGTTATTTTCTTATTTTCATTTTAT
SQ  TTTTTTCGCCTTTTATACAGACTTCAACACAATCAGAATCAAATAGGTGTATCGCAATGG
SQ  AATGTAATTTCTTAAGTATTCTATATGTACTTAAAACCTATTAATATATGGATCAACACA
SQ  GTATCTTATGAATGGGTTTTTGATTTTTTTATGTTTTTTTAAAACATTAAAGTTTTCGGC
SQ  ACGGACTTATTTGGAATTCAAATTATTAATGAAAGAACAATTAACTAATTAATGTACTTA
SQ  GTATTTGGCCATTATTATCGATTTCGGGGGCCAAATCTAACCAAATTCAACCTACATTTT
SQ  TTCAAATTGATTCAAACACCTTTCACAATAAGATTTTTATATCTAGCGCACATAGAATGA
SQ  AATGTAAACAAAGATTTCAGAAAAATCGTCATTCAAACTTGTATTAGACGAGGGACGGAG
SQ  TGATTTTTGTGTTTGTTTTTATTAATTGTGGGATAGGATAGTAGCAACTCTTGGAGGAGA
SQ  GCATTGTCAGTTGTCCAGTCTCTGAAGTTAAGTAGTAAGTTTGCGGAGTCAAAGGGGGAT
SQ  GGCTTTTGCCATTTGTGAGAGTTGTGCGGCAGCATCTTATTCAAATAGAGCTGTATTCTG
SQ  AAGACCTCTTGTAGAACATCATCCATACTAAAAAGTAAATCGTCCTGTCCCATTACGAGC
SC  EMBL #X59720; nt 10691-11771
XX
SF  note: shown is the approximate sequence containing the MAR
SF  as infered from [1]
XX
FF  has ARS activity [1]; overlaps with the E regulatory
FF  domain which is essential for repression of the HML locus
FF  [1]
XX
EV  re-binding assay (LIS) [1]
XX
BF  SB000097; RAP-1 [1]
MM  direct gel shift; 
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000097; RAP-1 [1]
MM  gel shift competition; 
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
XX
DR  EMBL: X59720; SCCHRIII
XX
RN  [1]
RX  MEDLINE; 89249338 PubMed; 2655930
RA  Hofmann, J. F., Laroche, T., Brand, A. H., Gasser, S. M.
RT  RAP-1 factor is necessary for DNA loop formation in vitro
RT  at the silent mating type locus HML
RL  Cell 57:725-737 (1989)
//