S/MARt DB - S/MAR

AC  SM0000504
XX
DT  24.2.2004 13:17:00 (created); ili2
DT  24.2.2004 13:33:00 (updated); ili2
XX
NA  HS$TH-MAR2
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1027 bp
XX
LO  11p15
DE  G002008; tyrosine hydroxylase
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G002008;
tyrosine hydroxylase

XX
SQ  CTGCAGAGGGCAGCGAGGAGCCACGGAGGGGTGTGGGACAGGGATGCCATGGCTGAAGCA
SQ  GTTTTAGGAAAGGTCCCAGGGGCTATTGTTGAAGAGAGAACGGGGAGCGGGGAGTCCCAC
SQ  AGCTGACAGGAGCAGAGTGGGCCCTGAGAGATGCCAGCTCTGGCTGCCACAGTGACCAGC
SQ  CGGGGTAGGCCTTCGAGAAGTCAGGGAGCGTCTAGGGCTTCTGGCTCCTGCTGGGCCCAG
SQ  GGTGTCATCTTGGGCTGCCAACACCAGAAAGCCCAGCAGATACAGGAAGCCCCAAGCCCT
SQ  GTCGGAAACGGTTCTTCTCCAGGAGGGACAGCGGTGGCAGCGTTCAGCCGCAGGCCATGC
SQ  ACTCTGGGGCCACGTCCTTCCCTCTGTACAGTCCAGCATTGTCAAGGCAGGCTCTGGCCA
SQ  TCTCTGCTGACCCCAGAGGGATGGGGAGGCCTCCCCTTCCACCAGAAGGGCCAGAAGCCA
SQ  CCCTGGGCAGGGGCATCACTCTCCCTGGGTGGGGCAGCGGCTGGGAGCAGGAGGTGCCAG
SQ  TGGGCGTGGGCTGGATGCGGGTGCCTGCGGGGCGGACATGGAACTTGGGGGAGGCTCTAG
SQ  GCTGGGGTTGTCCTCAAGGGAGTTCTCAGGTCACCCCAGGGTCACCCTCAACCCGGGGCC
SQ  TGGTGGGGTAGAGGAGAAACTGCAAAGGTCTCTCCAAGGGGAAGGCATCAGGGCCCTCAG
SQ  CACTGAGGGACGTGCGTGCTCTTTAAAGAAGGGGCCACAGGACCCCGAGGGAAGCCAGGA
SQ  GCTAGCAGTGGGCCATAGAGGGGCTGAGTGGGGTGGGTGGAAGCCGTCCCTGGCCCTGGT
SQ  CGCCCTGGCAACCCTGGTGGGGACTGTGATGCAGGAGGTGGCAGCCATTTGGAAACGCGT
SQ  GGCGTCTCCTTAGAGATGTCTTCTTCAGCCTCCCAGGGTCCTCCACACTGGACAGGTGGG
SQ  CCCTCCTGGGACATTCTGGACCCCACGGGGCGAGCTTGGGAAGCCGCTGCAAGGGCCACA
SQ  CCTGCAG
SC  Ensembl #ENSG00000180176
XX
SF  one of five successive fragments with MAR properties [1]
XX
TP  tissue-specific [1]
XX
FF  attachment is considered to be dependent on tyrosine
FF  hydroxylase gene activation [1]
XX
CP  adrenal medulla [1]
CN  liver [1]
XX
EV  re-binding assay (LIS) [1]
EC  matrices from normal bovine tissues [1]
XX
RN  [1]
RX  MEDLINE; 22218497 PubMed; 12231434
RA  Lenartowski, R., Goc, A.
RT  Tissue-specific association of the human tyrosine
RT  hydroxylase gene with the nuclear matrix
RL  Neurosci. Lett. 330:151-154 (2002)
//