S/MARt DB - S/MAR

AC  SM0000507
XX
DT  24.2.2004 13:20:00 (created); ili2
DT  24.2.2004 15:10:00 (updated); ili2
XX
NA  HS$TH-MAR5
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  336 bp
XX
LO  11p15
DE  G002008; tyrosine hydroxylase
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
XX
SQ  CTGCAGTCCCCTCGGAGCCCGGGGACCCCCTGGAGGCTGTGGCCTTTGAGGAGAAGGAGG
SQ  GGAAGGCCGTGCTAAACCTGCTCTTCTCCCCGAGGGCCACCAAGCCCTCGGCGCTGTCCC
SQ  GAGCTGTGAAGGTGTTTGAGGTGAGCTGGTGGCCTTCGTGTCCCTGGGGCAAGTTCACCT
SQ  GTGGGTGGGGCTGTGTGGGCTGAGTTCCTGACCCCTCTATAGCAGAGGTGCAGCTGCCCA
SQ  GGCCCCCGAGGCCGGCACAGGATGCAGCAGGGGAGTCTCAGGCCTCAGCTCAGCCCCCAT
SQ  GGCATCTAGCCACACCCCCTTTTTTTTGAGGGATCC
SC  EMBL #M23597; nt 2538-2866, edited
XX
FT  1 - 140: exon 3 [1]
XX
SF  one of five successive fragments with MAR properties
SF  [1]; contains a part of a 380 bp CpG island at its 5'
SF  end [1]
XX
TP  tissue-specific [1]
XX
FF  attachment is considered to be dependent on tyrosine
FF  hydroxylase gene activation [1]
XX
CP  adrenal medulla [1]
CN  liver [1]
XX
EV  re-binding assay (LIS) [1]
EC  matrices from normal bovine tissues [1]
XX
DR  EMBL: M23597; HUMTHC
XX
RN  [1]
RX  MEDLINE; 22218497 PubMed; 12231434
RA  Lenartowski, R., Goc, A.
RT  Tissue-specific association of the human tyrosine
RT  hydroxylase gene with the nuclear matrix
RL  Neurosci. Lett. 330:151-154 (2002)
//