S/MARt DB - S/MAR

AC  SM0000508
XX
DT  24.2.2004 16:33:00 (created); ili2
DT  24.2.2004 16:47:00 (updated); ili2
XX
NA  BOVIN$TH-3MAR
XX
OS  cattle, Bos taurus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; artiodactyla; ruminantia;
OC  pecora; bovidae
XX
SZ  959 bp
XX
DE  G009234; tyrosine hydrosylase
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
XX
SQ  GAATTCAAGGGAGCCTGTGCTGGGAAGACCCACTGGGCCAGCCTCCTCTCTGAGACTGCA
SQ  TGACTGGGGGCTTCCCGGGCTGGAGGAAGGGTCTCCAGTTCACTCTCAGGGATGGGCTGG
SQ  GATGATCTGCTCGTTTACAGAGCTTTAATGAAAACGTGGGTGGGGTTCTGGAAATTTAAT
SQ  TTGCAGGCACTGTCTCAGGGGACCTGCTATGGGGTAGAGGGTTGTTCCCTCTTCTCGGGG
SQ  TCCCAGCGAGGTGCCCCCCACCATGGAGGCCCCTGACTCTGTCCACACCCTGCCCGAGGT
SQ  TGGCTGGGGGGAGGGCTCCCCCAGGCCCGGCCATGTTCTGAGACCCGAGGGCTCCAGGGC
SQ  CTACTTGGAAGTTCAGCCCCAAGTGGTGAGCCCAGAGGGGCTTCTGCATTCAGGGAGTGA
SQ  TGAAGGCAGACACACCGACCCCGGGGGCTCGTGGTCTCAGGGACGGATGGCGGGTAAGGT
SQ  GCTGTCAGGCCGGACTAGAGGTGGGGCCACGAGGAGGGGTCATCCCAGACCCCTGGACGC
SQ  TGTGTCCTCTGGCCCCGGGGCAGCCCCAGACGGCTCCCGACCCACCGCCTCCCGTCCCCT
SQ  GACCCGGTCAGGTGGGCGCAGAGGCCGCCCTCGCCCCCAGCCCCAGGTGGGGAGGTGCTG
SQ  GAGCCGGCCCGGCGCTGTGGGCAGGCCGAGGGCGGGGGCAGCTGGCGCTCCTCTCCCCGC
SQ  AGTCCCCACGCTTCGTCGGGAGGCGGCAGAGCCTCATCCAGGACGCACGCAAGGAGCGGG
SQ  AGAAGGCGGAGGCCGCGGCCTCATCCTCGGAGTCCGCGGAGGCGGGCAGCCTGGTGGAGA
SQ  GGGACGGGAAGGCGGTGCTGACCCTGCTGTTCGCCCTGCGGCCCACCAAGCCCCCTGCGC
SQ  TGACCCGGGCTATCAAGGTGTTTGAGGTGAGGGGTGCCGGGGGCCGTGGGGACCTCGAG
SC  EMBL #AF510493; nt 700-1658
XX
FT  723 - 926: exon 2   [1]
XX
SF  contains putative ORI, topoisomerase II and H-box sequences
SF  [1]
XX
BP  considered as weak [1]
XX
FF  attachment is considered to be independent of tyrosine
FF  hydroxylase gene activation [1]
XX
CP  adrenal medulla, liver [1]
XX
EV  re-binding assay (LIS) [1]
XX
DR  EMBL: AF510493; AF510493
XX
RN  [1]
RX  MEDLINE; 22876518 PubMed; 14515167
RA  Lenartowski, R., Grzybowski, T., Miscicka-Sliwka, D.,
RA  Wojciechowski, W., Goc, A.
RT  The bovine tyrosine hydroxylase gene associates in vitro
RT  with the nuclear matrix by its first intron sequence
RL  Acta Biochim. Pol. 50:865-873 (2003)
//