S/MARt DB - S/MAR

AC  SM0000512
XX
DT  27.2.2004 16:51:00 (created); ili2
DT  8.12.2004 13:38:00 (updated); ili2
XX
NA  MOUSE$CMYC-5MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1697
XX
LO  15 D3
DE  G000489; 
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1

G000489;

XX
SQ  AGCCCTGCCCCCATCCGACCTCCGCCCTCGTTGGCTTCGCAACGCTGTGGTCTCTGTGGC
SQ  CAGTAGAGGGCACACTTACTTTACTTTCACAAATCCGAGAGCCACAACCCGGGTGGTGGG
SQ  GGGTGAGGGGGCGGGGAAAGAGTCTCTGCAGCAAAACGCAGACTAGGGATTGGTGGCTCT
SQ  TGGTGTTTGAGGCAAAATCCTAGAGGCTGTAGTCATTTTGCAATCCTTAAAGCTGAATTG
SQ  TGCAATGAGCTCGATGAAGGAAGATACTATCATTCAACAGCTGAATCCTAAATTGCAAAC
SQ  TCAGTGGCTAATAACAACTTTGAACAATGAGCACCTTATACACGCTACTGTATTTTCTTT
SQ  TCTTTCTTTTTTTTTTTTTTTTTTTTTTTTAAACCGGGTAGCAGTGAGAGAGGTTTCTTT
SQ  AAGTGCCTTGGGGCGAGGAGTCCGGAATAAGAAGACTTCTTTGGGTTTTAAAGTGTAGGA
SQ  TAAGCAAATCCCGAGGGAATATGCATTATATAATAAATCTAGAACCAATGCACAGAGCAA
SQ  AAGACTCATGTTTCTGGTTGGTTAATAAGCTAGATTATCGTGTATATATAAAGTGTGTAT
SQ  GTATACGTTTGGGGATTGTACAGAATGCACAGCGTAGTATTCAGGAAAAAGGAAACTGGG
SQ  AAATTAATGTATAAATTAAAATCAGCTTTTAATTAGCTTAACACACACATACGAAGGCAA
SQ  AAATGTAACGTTACTTTGATCTGATCAGGGCCGACTTTTTTTTTTAAGTGCATAATTACG
SQ  ATTCCAGTAATAAAAGGGGAAAGCTTGGGTTTGTCCTGGGAGGAAGGGGTTAACGGTTTT
SQ  CTTTATTCTAGGGTCTCTGCAGGCTCCCCAGATCTGGGTTGGCAATTCACTCCTCCCCCT
SQ  TTCTGGGAAGTCCGGGTTTTCCCCAACCCCCCAATTCATGGCATATTCTCGCGTCTAGCG
SQ  CCTTGATTTTCCCCACCCCAGCTCCTAAACCAGAGTCTGCTGCAAACTGGCTCCACAGGG
SQ  GCAAAGAGGATTTGCCTCTTGTGAAAACCGACTGTGGCCCTGGAACTGTGTGGAGGTGTA
SQ  TGGGGTGTAGACCGGCAGAGACTCCTCCCGGAGGAGCCGGGTAGAGCGCACCCGCCGCCA
SQ  CTTTACTGGACTGCGCAGGGAGACCTACAGGGGAAAGAGCCGCCTCCACACCACCCGCCG
SQ  GGTGGAAGTCCGAACCGGAGGTGCTGGAGTGTGTGTGTGGGGGGGGGGGGGAATCTGCCT
SQ  TTTGGCAGCAAATTGGGGGGGGGGGTCGTTCTGGAAAGAATGTGCCCAGTCAACATAACT
SQ  GTACGACCAAAGGCAAAATACACAATGCCTTCCCCGCGAGATGGAGTGGCTGTTTATCCC
SQ  TAAGTGGCTCTCCAAGTATACGTGGCAGTGAGTTGCTGAGCAATTTTAATAAAATTCCAG
SQ  ACATCGTTTTTCCTGCATAGACCTCATCTGCGGTTGATCACCCTCTATCACTCCACACAC
SQ  TGAGCGGGGGCTCCTAGATAACTCATTCGTTCGTCCTTCCCCCTTTCTAAATTCTGTTTT
SQ  CCCCAGCCTTAGAGAGACGCCTGGCCGCCCGGGACGTGCGTGACGCGGTCCAGGGTACAT
SQ  GGCGTATTGTGTGGAGCGAGGCAGCTGTTCCACCTGCGGTGACTGATATACGCAGGGCAA
SQ  GAACACAGTTCAGCCGA
SC  EMBL #AC134611; nt 150606-152302
XX
FT  1 - 1697: matrix binding [2]
FT  1 - 1697: origin of replication [2]
XX
SF  base unpairing region (BUR) [1]
XX
FF  in vivo SATB1 binding site [1]
XX
CP  thymocytes [1]
XX
EV  in vivo selection/LIS [2]
EV  flourescence in situ hybridization (FISH) [1]
EC  amplified FISH was carried out with nuclei, halos and
EC  nuclear matrices from wt and SATB1 knockout cells [1]
XX
BF  SB000001; SATB1 [1]
MM  chromatin immunoprecipitation (ChIP); 
SO  mouse thymus; mouse
QA  6
XX
DR  EMBL: M26861; MMDNAH
DR  EMBL: AC134611; AC134611
DR  EMBL: L00038; MMCMYC11
XX
RN  [1]
RX  MEDLINE; 22608347 PubMed; 12692553
RA  Cai, S., Han, H.-J., Kohwi-Shigematsu, T.
RT  Tissue-specific nuclear architecture and gene expression
RT  regulated by SATB1
RL  Nat. Genet. 34:42-51 (2003)
RN  [2]
RX  MEDLINE;  PubMed; 15145062
RA  Girard-Reydet, C., Gregoire, D., Vassetzky, Y., Mechali, M.
RT  DNA replication initiates at domains overlapping with
RT  nuclear matrix attachment regions in the xenopus and mouse
RT  c-myc promoter
RL  Gene 332:129-138 (2004)
//