S/MARt DB - S/MAR

AC  SM0000536
XX
DT  12.10.2004 11:15:00 (created); ili2
DT  12.10.2004 14:02:00 (updated); ili2
XX
NA  RAT$HST70-5MAR
XX
OS  rat, Rattus norvegicus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  3299 bp
XX
LO  6q24
DE  G010113; testis-specific 70 kDa heat shock protein
DP  Direction: 5'; 3402 - 120; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G010113;
testis-specific 70 kDa heat shock protein

XX
SQ  AAGCTTGATTTACTAATGCGTAGTGGCCTGTGGTTTTAATTTTTTACTTACTTTGGGTTT
SQ  CCTGTTTCAGTCTCTGGCTCATACTGGCCTGGAACTCACTATGCAGTGATCATCCCGCCT
SQ  CTTGGTCCCGACTGTGGAGATTAGGTATGTGCCACCACTCCCACCTGGGCTGAGCTTTTA
SQ  ATGTGTTCTGAATTATAATTATCAAAAGAAAAAGAGCCTGTTTTAAAACATAATACACAG
SQ  GAAACATAAAAGGTATTGACACAATGAGTATGTGTTTTTTGTGTGTGTGTGTGTGTGTGT
SQ  GTGTTTTTTTTTTTTTTTTTTGTTCTTTTTTTCGGAGCTGGGGACCCGAACCCAGGGCCT
SQ  TGCGCTTCCTAGGTAAGCGCTCTACCACTGAGCTAAATCCCCAGCCCCGAGTATGTGTTA
SQ  ATATTCTATGACTGAGAAGTGTCACCTGAAAGTCCTATTACCGTATCTTTATGGAGAAGG
SQ  CTCAAGATACGGGGTCCATATGAACCATGTAATTTTACCAGGGAAAAGTGAAAGCAGAAA
SQ  AATTCAGCTAATAAAAACACAGGTATAACTGCTGCTGCACCTCAGAAAATTGTTAAAATT
SQ  GGGGGAAGACTGCAAGTTTTGCTGCAACGACTGCATAAATGGGACATAGTTACTTCAGAA
SQ  ATGGACGTTTCCCTTTGACGGCCTAAGGGTCTCTGTATTTTCCAAGGGGGTTTGGGACAG
SQ  GCAGCTCTCAGTCTTGTTTTGCTGAAATTATAAGGAGAGAGCCTGAGTCGTGTGCAGTGC
SQ  TCTTGGAGGCCAGAAGAAGGCGTTGGATCCTTCAGAACTGGAGGTACAGATATTTGTTAG
SQ  CCACCATGTGGCTGCTGAGAACCGAACCTAGGTCCTCTACAAGAGCAAGCCTCAAGCCTC
SQ  TTAACTGCTGAGACATCTCTGCAGTCCGCTACCTTCCTTATTTAAAGATTCATTTTAAAA
SQ  TATATTTATAATAGTACAAATATAATGAAGGTGTTCTGTCTACACGGATGTGTACTTTCT
SQ  GCTTGCCTAAGGTTTATTTATTGTTTTACTTATGTGCTTGCTTTTATGAGTTTATGTGCA
SQ  CTTGAGTACAAGAGCCCAAGGACGTCAGAAAACAGTGACATTCCCTGGAACTGGAGTTAA
SQ  TGGTGGTTTTATGTATGCTGGGAACAGAACCCAGGACCCTGCCAGAGTAGTTAGTACTCT
SQ  TTATTGCTGAACTGTCTCTTCAGCTCCACCCCCCTCTCCTCTTCCATTGAACCTCCTTAG
SQ  TGCTAGGTAAGTAAGCACGGACTACCATTTATGCTCTGATATTTTCTTTAATCCTTTCCT
SQ  ATTTCAAGTTTTTCTTCAATTTCTTTCATAGAAAATAGAGAATTGCAGTTACCAATGGCA
SQ  AACGTGTTTTTGAAACTGTAAATTACATATCAGAATAGAAAGAATCTTTAAAACTTTTCC
SQ  TGATTAAATTTTATAGAACTCTGAGCTGGAGAGATGGCTCAGAGGGTAAGCCCACTTACT
SQ  GGTACACACACACACACACACACACACACACACACACACACACACATTTTAAAAATAAGA
SQ  AACTCTTTTATATGTTTTATAGAAATCTGTCAACATTACCTTTTAGACAACGAAAACGTT
SQ  CGTGTTTCTCATACAAAAATTCTTCTCCTTTACTGTCTCTCACATAACTTACTAGCCAGT
SQ  TTCAAAGGGGTGGTTCTCTCCTGAGGCTTCAAAGACAAAAATAAATCCCAACAGCACAAA
SQ  AAGCTGCTGAACATATCCCGGTTCCAGTCTTCAATTCTTTTTTTCTTTTTTTCGGAGTGG
SQ  GGACTGAACCCAGGGCCTTGTGCTTGCTAGGCAAGCCATTCGATTCTTAACTCATCTGCC
SQ  CTCACGGTTGCCCACACTCCAATACCTCAACCTGGTAAAGAATGCTTTTCCTACAGTCCT
SQ  CAACAGAATTAGGCATGTCACCTCCTCAGGGATGCTCTGACATGTTCCCTCAGGCTCAGT
SQ  GTGCCCCTCTCTGCCTTGTGTTCTCACTGGACTTCTCCCGATTTCTGTTTACCCTTCTCA
SQ  CACAATGGCCTAAGGACGGATCAGTTCCTTTTTTCTTCTCATCTCCTATTGGGACCCTGT
SQ  CAGTTTTAAGGCGACGACTGTCCTCAGCTTCCCATCCGTAAGGTGAAGCGGGCGGTGGCT
SQ  CTACATTACAGGTCTCCGTTTTCCTCCAGGAGTCCTTTTACAGGAGCCAGCTTCTGCCCA
SQ  CCCCCTGGTACCAGAGAGTACTTTCCAGAATTATTTTCATATTCCGGCTAAACAAGAGCC
SQ  AAGTTGTTCACTCTTCTCATCTACCTACCTCTACCAAGTCTGTGCTGCCAACCTAACTTC
SQ  TCCGCAGGGAAAAAGTCTCATTCAACCGAACTCCGCGGCCAAATGACTAGTTCCTAAACA
SQ  GGATGCCGTATGCGGGGACCGGAGTCAGAGGGTGACACACCGCGTAATAAGCGATGCCGC
SQ  GAAGTAGTCAAAACTGCCTATTAGGGCGCTTGAAAGAAGCTAAACCAGGAAAGCGGAGAG
SQ  AGAAGCTTGGACCGAGGCCGGGCAGCGGGTCCGAGCAAGGAAGTGGCTCGGGGGCCGTGC
SQ  TTCTCGCACTGGCGGGAAAGCCACCCGCCTCCCGGGTAAGCACCGCGCACGCAGCCTTCC
SQ  CCCGCCGCGCACTCTCCGAGACGCGCGAGGGGAAAAACTCGCACCCGCCCAACTTCACAG
SQ  TCCCCGCCCTGGAACCACCCCGCACCCAGCTCCGGTCCCCGCTGCAGGAACAGCAGAGGC
SQ  GGGAAAGACGAGAGCCGATCCCAGCCGTTCTTTTTTCGATGCAACCGTCTCAGAAAGAAT
SQ  TTCGACCCCGGGAGCCTTCGGGAGGCCAGCGCCCTTTCCGTGCTGCTCTGCGCGCCCCGC
SQ  CCCGCGCCGCGCCCCAGCGCCACACTCTTCGGGTTCCGCGCTGTTCATTGGGCATCTGCC
SQ  CCGCCAATCTAAAAGATGTCAACGAATCACGCTTTATAAAAGGCAAAGAGAGAGGGGAAA
SQ  GGGGGCTTTTCACGCTGGCTCCCTTGGCGCGAGCTTAACGCCCCCAAGCGGCTGGAGGCA
SQ  CTGGGCGGGGCTCATTTGCATAACGGCCGCCCCTTGGTCTCCCTGCTGGGGGCTGGAGTC
SQ  CCGCTCTCACCCACCTAGATATCTGTTGGACCACCGGCTGGTCACTCCGACCAGGCAAGC
SQ  CTGTGGGATCGCTGGACGGGTTGGACGGGCGGGCCCGGGGACCGATTGGCTCTGAGAGTT
SQ  TCCAGAAGGCAGGGGGTGGGGTGGGAGGACGACTATAAGACGGAGAAGCCCAGCAGGGG
SC  EMBL #X15705; nt 1-3299
XX
FT  1 - 923: fragment A [1]
FT  1 - 2523: matrix binding [1]
FT  806 - 1758: fragment alpha [1]
FT  924 - 2523: fragment B [1]
FT  1759 - 2231: fragment beta [1]
FT  2232 - 2523: fragment gamma [1]
FT  2232 - 2523: 2-3 times more efficient binding to matrices
FT                 from testis of adult animals [1]
FT  2232 - 2523: targeted by testis specific factors [1]
FT  2524 - 3299: fragment delta [1]
FT  2524 - 3299: low affinity to nuclear matrix [1]
FT  3069 - : transcriptional start T1 [1]
XX
SF  transcriptional start T1 is surrounded by DNase I
SF  hypersensitive sites in testis [1]
XX
TP  suggested to be involved in domain formation [1]
XX
FF  when included in the 5' region of transiently transfected
FF  reporter gene constructs hst70 gene promoter is
FF  downregulated [1]
XX
CP  testis, liver [1]
XX
EV  re-binding assay (high salt) [1]
EC  various subfragments were investigated [1]
XX
DR  EMBL: X15705; RNHST70A
XX
RN  [1]
RX  MEDLINE;  PubMed; 15048156
RA  Widlak, W., Widlak, P.
RT  MAR/SAR elements flank the rat hst70 gene transcription unit
RL  Cell. Mol. Biol. Lett. 9:123-133 (2004)
//