S/MARt DB - S/MAR

AC  SM0000537
XX
DT  12.10.2004 13:17:00 (created); ili2
DT  12.10.2004 13:36:00 (updated); ili2
XX
NA  RAT$HST70-3MAR
XX
OS  rat, Rattus norvegicus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1930 bp
XX
LO  6q24
DE  G010113; testis-specific 70 kDa heat shock protein
DP  Direction: 3'; 2178 - 4102; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G010113;
testis-specific 70 kDa heat shock protein

XX
SQ  AAGCTTAAGTATGTACGTGGAGATTTGCTTGAAATGAGAAACCTGATGTTTGCACACCTG
SQ  TCCTATGGAAGCTTGGTTACACTAAGATACAGAGAAGCTTGAATTATTTTTATGTACTAT
SQ  GAGATGAAAGTAAACACTGCGGTAATAAAGACAGGTATATTCTGTAAACACATAAATGCA
SQ  CATTCAAAGTAAAGCTGAAATTGATCTCAAAATTGCTGTCTGCTGTTTTCAGTCTCTTAT
SQ  GTTTGACTCACGTCGCTCTTTAAGAAAATGTGCTGTGAAGTTTGTCTAATCCACTTTTCT
SQ  CTAATTCTCAGACGAAGCGCCTGCCTCAAATCACCAATTTAAGGGGTGAAGAATCTTGGT
SQ  TAACCTTTAGCATACAGAAACCTGATGGGGTCTTTTCAGGTGAATCTAAACTCCTAAGTC
SQ  CTGGCTTTAGTATCCAGCTCTAAGACAACAGCAACAAGGCCATCTGAATGTTGCAGGGAA
SQ  GTACAAGCGGGACTCTAGTCCTGTACAAGGTAGTTTTTCTCCAGAGTAACAAAAATGACA
SQ  GCATCTTTCTCAATAGCCCAAGGGGCACAGAAACATGGGCTCTGATACACAGGGTCCTGA
SQ  AACAGGAGCCAGCAGGCAGGTTTCAAGATGATGCAATGTTGAGTCCCAGTGTGGGACTTG
SQ  TTTTTACTTCCTATAAAGCCTCTCAACTGTCTGAGCTTATGGCAAATTCCCTAAGAACCT
SQ  GAGTGGGAGTTTTAATTACTTCCCTTTTGAAGATCTTAGAGCTTTTACACTACCTGTCTC
SQ  AAATCACTACTACAGTTCTTTTTTAAAATCACATTTGTTTGGGGGTGGACAAGTCGTGTG
SQ  AGTGGTTCTCTCTACTATGTGTGTCCCCAGGATTGAACTCAGGTTTTTGAGTTGGTAGCA
SQ  AGTATCTTTACCTGCTGATCCATTAGGGTTTTAGTTTTTTGGGGGTTTTGTTTGTTTTGG
SQ  TGGGTTTTTTTTTGTTTTTGTTTTTGTTTTTTGTTTTTTGTTTTTTTTTTTTTGGTAAAT
SQ  TTTTTTTTCTTTTTCGGAGCTGGGGACCGAACCCAGGGCCCTGCGCTAAGTCCCCAACCC
SQ  CTGTTTGTTGTTTCTTTTGTTTTGTTTTGTTTTGTTTGGCATGGTTTGGTTTGGTTTTTT
SQ  GAGATAGGGTTTCTGTGTAGCCCTGGCTATCCTAGAACTTGCTTTGTAGACCAGGCTGGC
SQ  TCTTGCATTCAGATCTGCCTGCCTCTGCCTCCTGAATGCTGGGATTAAAGGTGTGTATGA
SQ  CCATTGGCTGGCTAGGTTTTATTTTTTAATGGAATTACATTTTAAAGTTCATTTAGGAGG
SQ  AATTTGGGGGAGTTTTAGTAGTTAATTTGAAGATGCATAATTTTAACAGCACATAGACAT
SQ  TTTATCTTTTTTACATAAAATTTTGCTTCATTTTTAAAATATTAGTGAGTTTTAGAAGCT
SQ  ATATTTCCAACTTATTGTGGATCCTTCTTTGTTAGTCACAGATTTATTTTTAGAAAAATA
SQ  GTTGTGTCAATTTAAAAATTAGAAGCAAGGGGTTGGAGAGATGACTCAGCGGTTAAGAGC
SQ  ACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAA
SQ  CCATGTATAATGAGATCTGATGCCCTCTTCTTTTGTGGCTGAAGAGAATGACAGTGTACC
SQ  TATATGAAATTTTTTTTTAAATTAGAAGCAAGGATATTGGGTTTAGAAATGACTGTCACA
SQ  TTATAGTTGACCCCTATGTAATAGATAGACCCTTTTTTTTTTTTTAACAAGGCTCACTTA
SQ  GATGGGGAAGGAAGATAAATAGACAGTTGTAAAACTGCTTCAGAATACTTACAACATTTT
SQ  CAAAGATTATACTTTGGAAATGTGGAGGCAGATTAATTAATCTATGCTGGTGTGACACTA
SQ  GTGAAAGCTT
SC  EMBL #X15705; nt 5597-7526
XX
FT  1 - 1459: fragment C [1]
FT  1 - 1930: matrix binding [1]
FT  1460 - 1930: fragment D [1]
XX
TP  suggested to be involved in domain formation [1]
XX
CP  testis, liver [1]
XX
EV  re-binding assay (high salt) [1]
XX
DR  EMBL: X15705; RNHST70A
XX
RN  [1]
RX  MEDLINE;  PubMed; 15048156
RA  Widlak, W., Widlak, P.
RT  MAR/SAR elements flank the rat hst70 gene transcription unit
RL  Cell. Mol. Biol. Lett. 9:123-133 (2004)
//