S/MARt DB - S/MAR

AC  SM0000547
XX
DT  1.12.2004 17:58:00 (created); ili2
DT  1.12.2004 18:08:00 (updated); ili2
XX
NA  HS$LAS81
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  57 bp
XX
LO  2q14.2
XX
SQ  CCCAGTCTTCATTCATTACCACAGAAGCCGCATCTTGGACACCAAGGATGCTCAGGG
SC  EMBL #X91578
XX
TP  regarded as functional [1]
XX
FF  originally termed loop attachment site [1]; stated to
FF  localize to a transcribed region [1]
XX
CP  HeLa [1]
XX
EV  in vivo selection of S/MAR [1]
EC  cells were encapsulated in agarose beads before they were
EC  subjected to mild lysis and enzyme digest [1]
XX
DR  EMBL: X91578; HSLAS81
XX
RN  [1]
RX  MEDLINE;  PubMed; 8614621
RA  Jackson, D. A., Bartlett, J., Cook, P. R.
RT  Sequences attaching loops of nuclear and mitochondrial DNA
RT  to underlying structures in human cells: the role of
RT  transcription units
RL  Nucleic Acids Res. 24:1212-1219 (1996)
//