S/MARt DB - S/MAR

AC  SM0000554
XX
DT  6.12.2004 17:12:00 (created); ili2
DT  6.12.2004 17:33:00 (updated); ili2
XX
NA  WHEAT$Dx5-5MAR
XX
OS  wheat, Triticum aestivum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1665 bp
XX
LO  1D
DE  G013633; high-molecular-weight glutenin Dx5; Glu-1D-1d
DP  Direction: 5'; 2098 - 434; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G013633;
high-molecular-weight glutenin Dx5; Glu-1D-1d

XX
SQ  GGATCCCAAGCGACAATTAAGGCGGTTAGCTATATTGTTCGCCTCCTCCGTGGAGTAGCC
SQ  AAGCACCATTACCTCGCTCTTTGCGAAGTTTATTGTAAGCCCCGACATCTCCTGAAAACA
SQ  AAGGAGCAAGAACTTGAGGTGTTGGATGTCGAGAGAAAACAATATGAAAATTCGTTTCAT
SQ  GCTTAATCCAATGATATCGACTTGATATTATGGATATTTGTATATTTCTCTACAAATTTG
SQ  ATCAACTTTAAAAGGTTTAACTTTTCAGAAAACTAATACACCTTATATTTTGAAACAGAT
SQ  GGAGTAGTTTTTTTTTAACCCCAACAACACCAACGACACAGCAAAGCGCGCCCAACCCTT
SQ  CTAGTTTAAATAACTAGCCTCCACTAACATATTTCTCTCGACATGCAAGCATGTCACTTA
SQ  AGAAAATGCCCACCTCAATATGCAACCATGCATAGAAGAAAGCTCTCTACACCCAGGGGC
SQ  AAATGCTCCTGGTGTGAACAGTAAAATCAAAAAAAAGTTCAAAAAATCTGAAATTTATTT
SQ  GTTTCATACTTCCACAAATGTTTGTTGTGCATGCAAAATTTCAACACAAAATCACATTGG
SQ  TGGAAGGCGTGGTAAAGAAACAAAATCGATGCTTCGAAAATGTTACTTACAAAAGCATTT
SQ  TGGAGTTTCGATTTTTTTTTGCACGACTTCCACCAATGTGATTTCGCGCTGGATTTTTGC
SQ  GTGCACGACAAACATTTGTTAATGTCACAAAAAAATCAGATTCTTTTAAATAAGTTCTAT
SQ  TTTTTTATTTTATTGTTCACACCAAAAGCATTTGCTCGTGGGTGTAGAAAGGCACTTTCG
SQ  TAGCTCAGCATGCAAATATGCAACATAATTTCCTTTTTACTTGGCTAATTATATTTGATA
SQ  AATATTTCACAAATATACAATAATCAAACACAATAAATCATATGTGTTTTTAGTTTTAGT
SQ  TCTCATATCCAAATATACTATAGCTAACCAAATCTCATCGGGAAGTTAGCCATGCCGAGG
SQ  TAGGTTGTTGCCGGAATGTTTTTAGTTTTAGTTCTCATACAACCAAATCTCATTCAAATA
SQ  TATAAAACATTCCGGCAACAACTTGTGGCGTACATCTAGTTACAAGGGAATATTAGTGAT
SQ  GGCGTGAGCAAGCGATAAGGCCAAGGAGAGAAGAAGTGCATCGTCTACGGAGGCCAGGGA
SQ  AAGACAATGGACATGCAGAGAGGCAGGGGCGGGGAAGAAACACTTGGAGATCATAGAAGA
SQ  AGATAAGAGGTTAAACATAGGAGGAGGATATAATGGACAATTAAATCTGCATTAGTTGAA
SQ  CTCATTTGGGAAGTAAACAAATTTTCTATTCTGTGTAAACCAAACTATTTGACGCGGATT
SQ  TTCTCTGAAGATCCTATATTAATTTTAGACATGGTTTGGCTAGTTCATTTGTCATGAAAA
SQ  GGTGTTTCCATAAGTCCAAAATTCTACCAACTTTTTTGTATGGCACGTCATAGCATAGAT
SQ  AGATGTTGTGAGTCACTGGATAGATATTGTGAGTCATAGCATGGATTCGTGTTGCTGGAA
SQ  ATCCAACTACATGACAAGCAACAAAACCTGAAATGGGCTTTAGGAGTTATCAATTTACTT
SQ  GTTCCATGCAGGCTACCTTCCACTACTCGACATGCTTAGAAGCTT
SC  EMBL #X12928; nt 1800-3464
XX
SF  contains a MITE designed Waffle [1]
XX
EV  re-binding assay (LIS) [1]
XX
DR  EMBL: X12928; TAGL1D1B
XX
RN  [1]
RX  MEDLINE;  PubMed; 11962634
RA  Anderson, O. D., Larka, L., Christoffers, M. J., McCue, K.
RA  F., Gustafson, J. P.
RT  Comparison of orthologous and paralogous DNA flanking the
RT  wheat high molecular weight glutenin genes: sequence
RT  conservation and divergence, transposon distribution, and
RT  matrix-attachment regions
RL  Genome 45:367-380 (2002)
//