S/MARt DB - S/MAR

AC  SM0000555
XX
DT  6.12.2004 17:45:00 (created); ili2
DT  6.12.2004 17:55:00 (updated); ili2
XX
NA  WHEAT$Dy10-5MAR
XX
OS  wheat, Triticum aestivum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1766 bp
XX
DE  G001818; glutenin subunit
DP  Direction: 5'; 2777 - 1012; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001818;
glutenin subunit

XX
SQ  CTCGAGAATGATGAAGGCCGCATCAACATGAAGTTTTACATAGTTCTCCGGTGGTTTCTC
SQ  CCGGCCTCCTCTGCGAGTGCCCACCTTTTTATTTTGCTCACCTGTAGTTAAGACATAGCG
SQ  GTTGTTAAGTTTTACATATTTTGTACTGCACTTAGTATAACTATAATTGTATTTTTAGTA
SQ  CTATTAAGTTATACTTAGAATTGGTTGCATGCTAAACACAATTAATAAATGGTGGATTAT
SQ  GTGGCACAATAAACAACTATTGGCAAATTTTCTGCATGCATGATTTCACTTGGATTCCTT
SQ  CCTAGTTTTTTTTTCCAGGAAGTCTTTCCTAGTTGATCCGCTTCCCCATTGATGCATCCT
SQ  CGCCTCAGGCAAACAATTACAATCTCTAGTGGTGATGAATGCTTTGTTGTTAATACAAGT
SQ  TTCTCTTAGTTATGAGCGGAACAAGAAGTAATATACACAAGTTTCTGCACCAAACCTAGA
SQ  GGCAAGGTGGCATTGGAGGATTGAGGATGTTTGTGTTTTTTCTTGTGGGGATGTCTGCAT
SQ  TTGTTGTTGAGGTGGATTATGACAATCTATCTTTTGCCCGTTTTATTATTTGTTCAACAT
SQ  TTTATTTGCTTCCATGGCTATCTATTTTTGTTGCCGATACAATGAATAAGGTTAATAAAG
SQ  CATAATTTAGCAACCACAAAATGTGTATTAGGAGTCAGGGCCGGGCCGGCAAACTCAGGG
SQ  CCCTATGCCAAACTCTAACAATGAGCCTACCATTAGAAGAACGTCCGGCAAAGAGATGCA
SQ  CTGCAACATATGACCAAAACGTCATCCATGATCGAGTACAATTTCTTAGTGCCTTTTTCA
SQ  TCAAAGTTATATTTGAAACATTTTAGAAAATTTGTCTTAAATTTTTTCCCATGGCGTTTC
SQ  GATCAAAAAAATGCCTTAAAACCTACCTATATAAAGGCAATAAGGGAAAACACTTCAGGA
SQ  TACCTTCGAAGCTAAGGTGTCTTTCTTTAGATGGTATGCTAAACTGTTCTTCATGGCGCC
SQ  TCAAATCATCATTCTGCAAGTAAAGACTAAAAATAACGCTAAATATGGAGTTAAAGGTTT
SQ  ACAAACGACGAGCGGAAAAGGAGTCTTATATAATTCCAGTAGCATTTATTCCATTTTGCT
SQ  TCACATAGAAAATGTAGCTGAGGTGGTCGATGTTTATTTTGACTCGCGTGAGGTCGCCGG
SQ  TTCGATCTCAGAAGCAACGCTGGAATATCCCATATAGATTTATTTTTCAGGCTGAGTGAT
SQ  GCTCGGGTACCTCCAGCGTATGGGCTGAAATTCGGCCCCCCTGCAAATCATGGGCCCTGT
SQ  GACGTTCGCACGGGTTGCACATGCCTTGGCCCGGGCCTACTAGGAGTGTACCTGGATTAT
SQ  GTTGGACGACGGGAGATGAAAGGGATGTATTAATTAACAAAGATAATGAAGCTTAATTTT
SQ  CTTATATGTTAATATTGACAAGAAACAAGCTGGGCCTAACTCAAAGTTACGGTTACATAG
SQ  TCGCAACCTTTTATATCTAAATAATATATCTCTCTCAATATGCAAACATGGCCACCTTAG
SQ  CATGTAGCATGCATGGAAAATTGTCCACTTCAACATGCAACCATGCATCAAAATTTCCAT
SQ  TTTACTAGGCTATTTATTTGATAAAATTTCACAAATATACAATAATCAAACACAATAGAT
SQ  CATATGTGTTTTCAGTTTTGGTTCTCACATTATTACTCCAAATATAAATGTTTCGTATAA
SQ  CCAAATTTCATTCAAATATACTGCAG
SC  EMBL #X12929; nt 161-1926
XX
EV  re-binding assay (LIS) [1]
XX
DR  EMBL: X12929; TAGLD12B
XX
RN  [1]
RX  MEDLINE;  PubMed; 11962634
RA  Anderson, O. D., Larka, L., Christoffers, M. J., McCue, K.
RA  F., Gustafson, J. P.
RT  Comparison of orthologous and paralogous DNA flanking the
RT  wheat high molecular weight glutenin genes: sequence
RT  conservation and divergence, transposon distribution, and
RT  matrix-attachment regions
RL  Genome 45:367-380 (2002)
//