S/MARt DB - S/MAR

AC  SM0000556
XX
DT  8.12.2004 12:52:00 (created); ili2
DT  8.12.2004 14:47:00 (updated); ili2
XX
NA  XENLA$CMYC-5MAR
XX
OS  clawed frog, Xenopus laevis
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  amphibia; lissamphibia; anura; archeobatrachia; pipoidea;
OC  pipidae
XX
SZ  811 bp
XX
DE  G013637; mycI
DP  Direction: 5'; 3127 - 2317; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  there is a second, minor, origin of replication between the
DC  MAR and the transcription unit [1]

G013637;
mycI

XX
SQ  GCAGGACCCATATTGCAGGTGCTTTTGGAGTTTTTATTGTTGTAATGTAATGTATAAGAA
SQ  TTGAGCTGGTGCTGCACATCATTCCTATCGTATGGACACAGTGTATAATACTCCGGGTAG
SQ  AGATGGAACAGATGTTACTAAACATGTTTCTAGGGTTTGTTTCCTCTATGAGCTTCGCTT
SQ  CTAATCACTTTTTTTTTTCTTTTCCCCTTTTGACTCCGAAATCGGTGAATCTTTAAGATA
SQ  AAAGTGTGACGGATAAATGATCCGCTTTCTGTCCCGGCGACAGCTGAGGGGCTGGAAAAT
SQ  CCCAAATCCATATCTGCTTGTGAATGTGCCCTTTTATTTCTCATTGACTCGATCTTCTTT
SQ  TTTTTTCTTAAACCCCCCCCCCCCCTCCCTCCTCTGTTTAATACTTTTTGTTTAGGAGTG
SQ  TAATTTGGAAAGGGGCCTGGAATGATAATCCGGGAGTTTTAGCAGCCATTCTCTTTACCC
SQ  TAAATTACCTTAGTCATGATGTGAGGCCCTCGCACGGCAATCACTCATTACAATACTCAC
SQ  AAGAGTTGATGCCTTTCAACAATGTCACCCTACCCAACCCCCAACGTTTTTTGTTCCATC
SQ  ACTAGAGGGCGCTGTTGATTCACTGAAGCTGCAACTGTTTCACCAGAGGAAACACAGTGA
SQ  GGTTTCTTTTTTTACATAGTCAAGTATTTCTCCTCCCAGGGTGTCTGAGCAGTTGCATCT
SQ  CCCTCTCTATATATTTATATTTATATATACACATATCAAGCCTCCAGGAAAATAAATAGC
SQ  AACAGACACTGCTCCAGTTCCAGCTCCTCTG
SC  EMBL #AJ605770; nt 1157-1967
XX
FT  1 - 333: major origin of replication [1]
FT  80 - 811: matrix binding [1]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AJ605770; AJ605770
XX
RN  [1]
RX  MEDLINE;  PubMed; 15145062
RA  Girard-Reydet, C., Gregoire, D., Vassetzky, Y., Mechali, M.
RT  DNA replication initiates at domains overlapping with
RT  nuclear matrix attachment regions in the xenopus and mouse
RT  c-myc promoter
RL  Gene 332:129-138 (2004)
//