S/MARt DB - S/MAR

AC  SM0000557
XX
DT  8.12.2004 17:35:00 (created); ili2
DT  9.12.2004 13:09:00 (updated); ili2
XX
NA  HS$LMNB2-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  3370 bp
XX
LO  19p13.3
DE  G013638; lamin B2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G013639; translocase of inner mitochondrial membrane 13 homolog (yeast)
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  locates to a BamH I fragment of ca. 12 kb which comprise
DC  the TIMM13 and (part of) the lamin B2 genes [2]

G013638;
lamin B2
G013639;
translocase of inner mitochondrial membrane 13 homolog (yeast)

XX
SQ  GGGGACCCGAGGACCACCTCAAGAGGCTGCTACGTGATGTGAACCCACACTCCTCATCCA
SQ  CACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTTATCATTGGCTTTCTTTAGTT
SQ  CTTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCC
SQ  CAGCCCTCCCTCCTGGCGGGTCTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCC
SQ  CGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATTTGGTCAAATTGGAAGCCCA
SQ  GGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGC
SQ  TAGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTC
SQ  AGTGGTGGTGGGTTTTTTTAAGGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGAC
SQ  CTGGTGGGGCCCGGGGCAAGCCTGCATTCTGGCTGCCCAGCTTCGGACAGCGGGAACTCC
SQ  TCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCAGGGGGGTTT
SQ  TCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGACCGGCCGGGTTTCTCGG
SQ  ACCGTTGACTTTATTTGGGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAA
SQ  CAGGGCAGGGGAGGGGAAGACCTGGGGAAGGAAGAATGAGGACACAGTCCCGTCGTAAGA
SQ  CCTGTCACAACAATAAGCAGGGAGGGGAGATGTGGAGGGGACACATCTGGTTGCCTTGGA
SQ  GGCAGAAGCTGTGAGTTTCAGAACAGCTGTCTGCAGGGAACGCCACCATGTTGACCCTCT
SQ  GGAGGAGAGCGCTGTGGAGCCCCTCCCGTGTTCCAGCTCCGTCTGCCCTGTGCCTATATA
SQ  TCACATGCGTCTATCATACTGTGTCTTTATCTGTGATTTTTCTCGCTGAAACATGTTTCT
SQ  CAGACAGCCAAGGCCACCTGACTCCTATCACGACGCACCCAAGCCCCTCAGTCCAGCTTC
SQ  CCAATGCCTGGCACCCCCTTCGGCAATAGCTCACCGTTTACACCCTCCCTCATAGATACA
SQ  CAGAAGTTATTTTTTTAATGGATATTTATTTTTTTACATTGGTCAGTACACAGGTCAGGG
SQ  AGCTCACGCCAGGGCCTTGAGGACAGGCTGACCCTCCTCCCCGGGGTGGCGTGGGGCTGG
SQ  GGCACCCCCGACGGCAGAGCCTCCTTCAGAAAGTGCAGCTCAAGTCTTAAAGACACCAAA
SQ  ACTGAGCCATGGGCACGCGCCGTCTCCGGGCCATGGCGTTCACTGCAGGGCGGGGGCGGC
SQ  ACCGCTCCCCTGTGACTGCATCCCGCCTCCCTGGGGACCTGCCTGTGGCAGGAAGGAATG
SQ  GGGGGCCCCAGCCCAGGCCGGGAAGGAGCCAGCGGCCGACAAAGCAGAAACACCGCTGCT
SQ  CCACGTAGCCCCTGCTGGCTGTCCTTGCTCTCAGAAGTCCCGGTCCCATGTAGATAGAGC
SQ  CCGGCGGATCTTACCAAAGCATTTCCTCCTGGAGGCTACGCCGCTTGGTGCTCCCAGTGA
SQ  GGCGGCTGGTAGGGAGCTTTGCCTGCCCCGGGGATACCCTCTACCAGCCGCTGGAAGTGG
SQ  GAATGCTGGCGACAGACTGTGTCTGTTTCCCACCTTCATAGCAGGAATCACCCGGACCCG
SQ  ACTGGCTGGGCTTCGTGCTAGCGAGGGTTTTCTGGGGGTGGGTCTTGGTGATCTTGTCCT
SQ  ATGGGGATCTCTGCAGTGGTCTCAGCCACATCCTAGTATATTTTGGCTCTGGAGGAGCAA
SQ  AGCTGTATCCTGGAGTTGGTCTGTGATTTGCCGACAGACTTGCAGGCTGGGCTCAGCAAA
SQ  GTCCCCCCCAAAACCCGCAGGTCCTCATGTCCAGACGCTGCCAGTCCTGTCCTGAAAACA
SQ  GCACGCCCCAGGCCCACAGAACCCCCCACCCTACATTTGCCTTGGGTGGAGCTGGGGGTG
SQ  GTCCTAGGACTGCGGGTGCCCTTAGCTGAAGGGGGCCCGCAGAAGCGTGAGCTGGGCCGC
SQ  CTGTGGGTCATTGGAGGTTCATTGAGAATTGAGTCCTTTGGAAAGACTAAGAAAATCAAA
SQ  TTTTTAAAAGTTATTTATGGCCTGGGAAACAATTTGCATTTGTCCCCAAATACGCTTAGC
SQ  TGTGTGCCGCTTAGAACGATGAGAAACCATCCCTCTGTGTAAGCCCGTGCCGTGTGACTC
SQ  GAAGCCTAGCGCCCTCCCTGCGAAGCATCAGACGCCACCCAGCCCTGGGGGAGGCCCACG
SQ  CCTGCTGGACCAACGCGGGTTCTGGGGTGCACAGCGCCAGGTTAACGCTGAAGCCTGCCC
SQ  CGCTGAGCCCAAGAGCCGGGAGGCCTGCGGGCTGACCCAGAATCCGATCATGCACCTGTC
SQ  CTCATGCCAGCGGCTTTGGCTGGGGTTGGTCTGAAGCCTGCACGCGGCAGTTCTTTGTTA
SQ  AAGATCTGAGGGACTCGTCAGTCCTAGCGTCGCCGCCTGCAGCCTCTTCCAAGCCCTGCG
SQ  TCCAGCGAGCGTCACAGCACAACCTGCAAAAACGGAGCTGGGCTGCAGCTGGGGCTGGCA
SQ  TGGACTTTCATTTCAGAGATTCGGTTTTTAAGAAGATGCATGCCTAGCGTGTTCTTTTTT
SQ  TTTTCCAATGATTTGTAATATACATTTTATGACTGGAAACTTTTTTGTACAACACTCCAA
SQ  TAAACATTTTGATTTTAGGTTCTGCCTCTGAGTTTATTCCTGAGGGGAAGCTCGAGCCGG
SQ  GCCTCTGCCCTAATGAAGCGGATGTCTAAGAAAGATCCCTCCACCCCCAAGGAAAAAGGT
SQ  CACTGGCTAGTGTAGCTAGTGTAAACAGGACCCAGGCGATGCATGGGACCCTGCCCTTTT
SQ  TTTTCTAGTGAGCCTCCGACGCTGTTGCACAAGCTGACTCTTCGTCACGTGATGCGACCG
SQ  GCTCCGCCCCGGCGGCAACACGCTGTATAGACGCGCCGGGTGCCTCGTGCGCATGCGCGG
SQ  CAGGCCCTTCGGGACGAGCTGGAGGCAGAGCGTGAGTACAAAGTGATCGGCCTCGGCCGA
SQ  CGCAGTAGCCCCCCTACTCCCCGGCCAAGTCAGGGCCTCCCTCTTCCCGCGGAGTCGCAA
SQ  CCACGGGTAGCTCGTGTAGGTAACGGCAGGTCCAGGCCTCCGCATGAGCGGAGGGCCCCC
SQ  CGCACGACCTTGAATGGCCCGGTGGCGCGCGCGGTCGTGTGGGAGTTGTAGTCCTCCGTC
SQ  CCCGTCCGCGCGGACTCCGTTTCCCGTGGTGCCCCGGGCGGCCCGCTTCCGGCGCAGTTA
SQ  GTTACGAGTC
SC  EMBL #M94363; nt 1207-4576
XX
FT  1 - 3370: matrix binding [2]
FT  1 - 2776: last exon of lamin B2 gene [1]
FT  2617 - 3091: origin of replication [1]
FT  2777 - 3370: non-coding region [1]
XX
FF  originally termed loop achorage region [2]
XX
EV  topoisomerase II cleavage assay [2]
XX
DR  EMBL: M94363; HSLAMB2B
XX
RN  [1]
RX  MEDLINE;  PubMed; 8041756
RA  Giacca, M., Zentilin, L., Norio, P., Diviacco, S.,
RA  Dimitrova, D., Contreas, G., Biamonti, G., Perini, G.,
RA  Weighardt, F., Riva, S., Falaschi, A.
RT  Fine mapping of a replication origin of human DNA
RL  Proc. Natl. Acad. Sci. USA 91:7119-7123 (1994)
RN  [2]
RX  MEDLINE;  PubMed; 9513042
RA  Lagarkova, M. A., Svetlova, E., Giacca, M., Falaschi, A.,
RA  Razin, S. V.
RT  DNA loop anchorage region colocalizes with the replication
RT  origin located downstream to the human gene encoding lamin
RT  B2
RL  J. Cell. Biochem. 69:13-18 (1998)
//